ID: 1052799532

View in Genome Browser
Species Human (GRCh38)
Location 9:32955495-32955517
Sequence CAGCCCCACTAGAAGCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052799532_1052799534 -8 Left 1052799532 9:32955495-32955517 CCTCAAAGCTTCTAGTGGGGCTG No data
Right 1052799534 9:32955510-32955532 TGGGGCTGTCATGTAGGTTGTGG No data
1052799532_1052799536 9 Left 1052799532 9:32955495-32955517 CCTCAAAGCTTCTAGTGGGGCTG No data
Right 1052799536 9:32955527-32955549 TTGTGGTCGCTTTGGATAACAGG No data
1052799532_1052799535 1 Left 1052799532 9:32955495-32955517 CCTCAAAGCTTCTAGTGGGGCTG No data
Right 1052799535 9:32955519-32955541 CATGTAGGTTGTGGTCGCTTTGG No data
1052799532_1052799537 20 Left 1052799532 9:32955495-32955517 CCTCAAAGCTTCTAGTGGGGCTG No data
Right 1052799537 9:32955538-32955560 TTGGATAACAGGAGACGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052799532 Original CRISPR CAGCCCCACTAGAAGCTTTG AGG (reversed) Intergenic
No off target data available for this crispr