ID: 1052800207

View in Genome Browser
Species Human (GRCh38)
Location 9:32959597-32959619
Sequence CTCTCGGCAGAAACTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052800203_1052800207 11 Left 1052800203 9:32959563-32959585 CCACAAAGGGAAGCCCATCAGAC 0: 5864
1: 2938
2: 903
3: 329
4: 257
Right 1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG No data
1052800202_1052800207 12 Left 1052800202 9:32959562-32959584 CCCACAAAGGGAAGCCCATCAGA 0: 4645
1: 4506
2: 1938
3: 878
4: 1128
Right 1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG No data
1052800199_1052800207 29 Left 1052800199 9:32959545-32959567 CCAGAAAGGTCAGGTTACCCACA 0: 9
1: 19
2: 16
3: 33
4: 124
Right 1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG No data
1052800204_1052800207 -2 Left 1052800204 9:32959576-32959598 CCCATCAGACTAATAGCAGATCT 0: 60
1: 1754
2: 5039
3: 3737
4: 2327
Right 1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG No data
1052800205_1052800207 -3 Left 1052800205 9:32959577-32959599 CCATCAGACTAATAGCAGATCTC 0: 55
1: 1694
2: 5037
3: 3187
4: 1789
Right 1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052800207 Original CRISPR CTCTCGGCAGAAACTCTACA AGG Intergenic
No off target data available for this crispr