ID: 1052801079

View in Genome Browser
Species Human (GRCh38)
Location 9:32969002-32969024
Sequence GACACCTGTGTCAATACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052801079_1052801080 5 Left 1052801079 9:32969002-32969024 CCAAGTGTATTGACACAGGTGTC No data
Right 1052801080 9:32969030-32969052 CTCAACGAAATTTTATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052801079 Original CRISPR GACACCTGTGTCAATACACT TGG (reversed) Intergenic
No off target data available for this crispr