ID: 1052802170

View in Genome Browser
Species Human (GRCh38)
Location 9:32978936-32978958
Sequence ATATGCTTTTAGTAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052802170_1052802172 18 Left 1052802170 9:32978936-32978958 CCATCACACTACTAAAAGCATAT 0: 1
1: 0
2: 3
3: 22
4: 239
Right 1052802172 9:32978977-32978999 TGTTTTGCTAACTACCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052802170 Original CRISPR ATATGCTTTTAGTAGTGTGA TGG (reversed) Intronic
901372845 1:8815280-8815302 GCATGTTTTTAGTGGTGTGATGG - Intronic
901922360 1:12546461-12546483 ATATTTTTTTAGTAGAGTCAGGG - Intergenic
903531511 1:24033986-24034008 TTATGCTTTTAGTAGAGACAGGG + Intergenic
904782363 1:32960282-32960304 ATGTGCATTTGGTAGGGTGAGGG - Intronic
906050241 1:42865002-42865024 TTATGCTGTTGTTAGTGTGATGG - Intergenic
906539686 1:46575814-46575836 TGAGGCTTTTACTAGTGTGAAGG + Intronic
906582748 1:46949893-46949915 TTATACTTTTAGTAGTGACAGGG + Intergenic
906885883 1:49647924-49647946 ATAGGCCTTTAGTAATGTGGTGG - Intronic
908583091 1:65538538-65538560 ATATACTTTTAGTAATGTAATGG - Intronic
908985130 1:70008404-70008426 ATAAACTTTTAGCACTGTGATGG - Intronic
909062905 1:70899678-70899700 TTATGCTAGTAGTTGTGTGAAGG + Intronic
911324511 1:96454236-96454258 AAAAGCTTTTAGTAGAGTGTTGG + Intergenic
912095674 1:106140002-106140024 ATATGCTTTTATTTATCTGAAGG - Intergenic
915297725 1:154933259-154933281 TTATGCTTTTAGTAGAGACAGGG - Intronic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916760801 1:167815571-167815593 ATAAGTCTTTAGTAATGTGATGG - Intronic
918809713 1:189100239-189100261 ATATACTTTTAGTAATGTAAGGG - Intergenic
921428442 1:215033488-215033510 ATAGGCTTTTAGTAATGTGGTGG + Intronic
921769407 1:219017601-219017623 TTAGGCCTTTAGTAATGTGATGG - Intergenic
921963796 1:221065904-221065926 ATATGCTTGTATGAGTATGAGGG + Intergenic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
924690624 1:246346342-246346364 ATAGGCCTTTAGTAGTGTGATGG - Intronic
1063280359 10:4622413-4622435 AAATGCTTTTAGAAGTAGGAAGG - Intergenic
1065025534 10:21535750-21535772 ATATGTTTTTAGTAGTCTGTTGG + Intronic
1065451262 10:25860392-25860414 AAATGCGATTAGTATTGTGATGG - Intergenic
1065477708 10:26158628-26158650 ATACGTTATTAGTAATGTGAAGG + Intronic
1065670270 10:28108721-28108743 CTCTACTTTTAGTAGTGAGAGGG - Intronic
1071077711 10:81774377-81774399 ATATTTTTTTAGTAGTGACAGGG + Intergenic
1071080798 10:81807464-81807486 ATAGGCCTTTAGTAATGTGGTGG - Intergenic
1072939260 10:99745310-99745332 ATATAGTTTTAGTGGTGAGAAGG + Intronic
1073241415 10:102061134-102061156 ATATTTTTTTAGTAGAGAGAGGG - Intergenic
1073639361 10:105234969-105234991 ATAAGTCTTTAGTAATGTGATGG + Intronic
1073782580 10:106855974-106855996 ATAGGCCTTTAGTTGTGTGATGG + Intronic
1074166746 10:110885666-110885688 ATATAATTTTAGCAGTTTGAGGG + Intronic
1074727599 10:116328647-116328669 ATATTCTTTTATTATTGTTATGG - Intronic
1078130312 11:8608941-8608963 ATATGCTTTGAGAAATGAGAGGG - Intergenic
1080841085 11:35984161-35984183 TTTTGCAATTAGTAGTGTGAGGG - Intronic
1081340365 11:41920339-41920361 ATAGGCCTTTAATAATGTGATGG + Intergenic
1082623332 11:55452561-55452583 ATATTCATTTAGCACTGTGAAGG + Intergenic
1083668369 11:64287210-64287232 GAATGCTTGTGGTAGTGTGAGGG + Intronic
1084288927 11:68149237-68149259 TTATGCTTTTAGTAGAGAAAGGG - Intergenic
1086315361 11:85585890-85585912 ATATGTTTTTTGTAGTGACAGGG + Intronic
1087104725 11:94398194-94398216 AAATGCTGTCAGGAGTGTGAAGG - Intronic
1087271200 11:96113814-96113836 ATATGCTTTCAGTGGTTTCAAGG - Intronic
1088662395 11:112060636-112060658 GTATGTTTTTAGTAGTGTCGGGG + Intronic
1088672652 11:112158154-112158176 GTATTCTTTTAGTAGTGAGGGGG + Intronic
1088929345 11:114333986-114334008 ATAGGCCTTTAGTAATGTGTTGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1091255185 11:134177687-134177709 AGATGATTTTATTAGTGTAAAGG - Intronic
1092806308 12:12226220-12226242 ATAGGCCTTTTGTAATGTGATGG - Intronic
1093108210 12:15115519-15115541 TTATGCTATTATTAGTGTGTGGG - Intronic
1095531330 12:43190070-43190092 TTGTACTTTTAGTAGTGAGACGG + Intergenic
1095836618 12:46646939-46646961 ATAGGCCTTTAGTAGTGTGGTGG + Intergenic
1096003956 12:48153604-48153626 ATCTGCTTTTAGCATTGGGAAGG - Intronic
1096908486 12:54959096-54959118 ATAGGCTTTTAGTAATGTGGTGG + Intronic
1096930535 12:55203742-55203764 ATCTATTTTTAGTAGTTTGAGGG - Intergenic
1097240871 12:57574444-57574466 TTATGTTTTTAGTAGAGAGAGGG + Intronic
1097456370 12:59803630-59803652 ATAGGCCTTTAGTAATGTGGTGG + Intergenic
1098998317 12:77147418-77147440 GTATGCTTTCAAGAGTGTGAAGG - Intergenic
1099065232 12:77968799-77968821 ATGTGCTTGTATCAGTGTGATGG + Intronic
1099409520 12:82307297-82307319 ATAGGCATTTAGTGGTGTGATGG - Intronic
1099672555 12:85713099-85713121 ATCTGCCTTGAGTAATGTGAAGG + Intergenic
1100149642 12:91720677-91720699 ATATGCTTTAAATCATGTGATGG - Intergenic
1100961401 12:99966672-99966694 CTATGCATTTAGTATGGTGATGG - Intronic
1101555890 12:105808980-105809002 TTATACTTTGAGTACTGTGAGGG + Intergenic
1103755333 12:123201104-123201126 TTTTGCATTTAGTAGTGTGGGGG - Intronic
1104268780 12:127263284-127263306 ATAAGCTATTAATAGTGTCATGG - Intergenic
1106963725 13:35034155-35034177 ATATGCTTTTTGTTGTGTTGAGG + Intronic
1108595821 13:51948201-51948223 ATATACTTTTAATTATGTGAAGG + Intronic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1111132333 13:83993190-83993212 ATAGGCTTTTAGTACTATGGTGG - Intergenic
1111227797 13:85297442-85297464 ATTTGCTTTTAATAGTGATATGG + Intergenic
1111238637 13:85444080-85444102 ATAAGCTTTTAAAATTGTGATGG + Intergenic
1111355722 13:87099439-87099461 ATATGTTTTTAATAGTGAGTTGG - Intergenic
1111428631 13:88123505-88123527 ATATGCTTTAGGTATTGTTATGG + Intergenic
1112556478 13:100472985-100473007 ATATGCATTTATTAGCTTGAGGG + Intronic
1113005683 13:105699585-105699607 AAATGTGTTTAGTAGTTTGAAGG - Intergenic
1114348245 14:21820794-21820816 ATATGCTGTTAGTGCTGTGGTGG + Intergenic
1115914794 14:38299790-38299812 ATAGACTTTTAGTAATGTGGTGG - Intergenic
1120501685 14:85305124-85305146 AAATGCTTTTTGGAGTGAGAGGG - Intergenic
1120933325 14:89870416-89870438 ATATGGCTTTAGTAGAGTGGAGG - Intronic
1121802455 14:96785974-96785996 GGATGCTTTTGGTGGTGTGAAGG + Intergenic
1124465392 15:29934808-29934830 CTTTGCTATGAGTAGTGTGAAGG + Intronic
1125207964 15:37176543-37176565 ATATGAATTGAGTGGTGTGAGGG - Intergenic
1125336785 15:38634768-38634790 ATAGGTTTTTAGTGCTGTGAGGG + Intergenic
1126821219 15:52506039-52506061 ATATTTTTTTAGTAGAGAGAGGG - Intronic
1127275795 15:57442789-57442811 TTGTGTTTTTAGTAGGGTGAGGG + Intronic
1128470196 15:67945292-67945314 ATCTGCTTTGAGTAGTCTGTAGG - Intergenic
1128969952 15:72099727-72099749 TTATGTTTTTAGTAGAGTCAGGG - Intronic
1130264248 15:82384871-82384893 ATATACTTTTAAGAGTGTAAAGG - Intergenic
1130276768 15:82482761-82482783 ATATACTTTTAAGAGTGTAAAGG + Intergenic
1130309725 15:82742688-82742710 ATAGGCCTTTAGTAATGTGGGGG - Intergenic
1130469132 15:84210125-84210147 ATATACTTTTAAGAGTGTAAAGG + Intergenic
1130474507 15:84252117-84252139 ATATACTTTTAAGAGTGTAAAGG - Intergenic
1130476622 15:84324681-84324703 ATATACTTTTAAGAGTGTAAAGG + Intergenic
1130481922 15:84366165-84366187 ATATACTTTTAAGAGTGTAAAGG - Intergenic
1130495143 15:84463449-84463471 ATATACTTTTAAGAGTGTAAAGG - Intergenic
1130591425 15:85214736-85214758 ATATACTTTTAAGAGTGTAAAGG + Intergenic
1135098911 16:19588882-19588904 ATACGCTTGTAGTAGTATGTGGG + Intronic
1137549144 16:49424931-49424953 ATATCCTTTTAGGAATGTAATGG + Intergenic
1142638466 17:1271618-1271640 CGATGCTTTTAGGAGAGTGAGGG + Intergenic
1143717212 17:8782689-8782711 ATAAGCCTTTAGTAATGTGGTGG - Intergenic
1145297788 17:21607138-21607160 ATATGGTTTTAGTACTTTGTTGG - Intergenic
1145352470 17:22096273-22096295 ATATGGTTTTAGTACTTTGTTGG + Intergenic
1150523466 17:65894642-65894664 ATTTGCATTTAGTAGTGGTAAGG - Intronic
1153379172 18:4416953-4416975 ATATATATTCAGTAGTGTGAGGG + Intronic
1153445362 18:5166122-5166144 ATAAGCATCTATTAGTGTGAAGG + Intronic
1154053455 18:10986573-10986595 ATATGGTTTTCGTTGTGTTAAGG - Intronic
1154352150 18:13593138-13593160 ATGTACTTTTAGTAGAGTCAGGG - Intronic
1156663337 18:39375366-39375388 ATATGCCTTTAATAATGTGGTGG + Intergenic
1157350550 18:46881070-46881092 ATAGGCTTTCAGTAGGGTGGTGG - Intronic
1158352726 18:56579097-56579119 ATAGGCTTTTAGTAATATCATGG - Intergenic
1158661384 18:59391457-59391479 ATTTCCTTTTAGTAGTGAGAAGG - Intergenic
1160056167 18:75482919-75482941 ATAAGCCTTTAGTAATGTGGTGG - Intergenic
1160358540 18:78249482-78249504 ATAAGCTTTTCGCAGTGAGAGGG + Intergenic
1161532493 19:4798434-4798456 TTGTGCTTTTAGTAGAGAGACGG - Exonic
1164530656 19:29045974-29045996 ATCTGTTTTTAGTAGTGGGGAGG + Intergenic
925528735 2:4836010-4836032 ATTTGCCTTTTGTAGTGTGTTGG + Intergenic
928379657 2:30806725-30806747 ATATGCCTCTAGTGGTGTCATGG - Intronic
929123626 2:38503386-38503408 CTATGCATTTAGGAGTGTGTTGG - Intergenic
929552127 2:42901073-42901095 AAATGCTTTTTATAGTTTGAAGG + Intergenic
930215387 2:48691166-48691188 ATATGCTTTTAATAATATGTAGG - Intronic
930540456 2:52699537-52699559 ATATGCTGTCAATATTGTGAGGG + Intergenic
931496076 2:62808732-62808754 ATAGGCCTTGAGTAATGTGATGG + Intronic
932116501 2:69054848-69054870 CTGTTCTTTTAGTTGTGTGAGGG + Intronic
935693672 2:105752034-105752056 ATATTCTTTTATTTGCGTGAGGG + Intronic
935846518 2:107171731-107171753 TTGTGTTTTTAGTAGTGTCAGGG + Intergenic
936698891 2:114986243-114986265 GTATGCTTTTAGAAGTTTGTGGG - Intronic
936786616 2:116100709-116100731 ATATATTTTTAGTAGTATGGTGG - Intergenic
940070368 2:149679791-149679813 TTATGCTTTTATTACTGTGTAGG + Intergenic
940137180 2:150451080-150451102 ATATGATTCTAGTTGTATGAGGG - Intergenic
941178037 2:162223892-162223914 ATATGCTTTTTATGGAGTGAGGG - Intronic
942718624 2:178923449-178923471 ATATTTTTTAAATAGTGTGATGG - Intronic
942850998 2:180485346-180485368 ATTTGCTTTTTGTAGTGACAGGG - Intergenic
943085975 2:183311697-183311719 ATTTGCTTTTGGAAGTGTGTTGG + Intergenic
943384772 2:187187753-187187775 GTATTGTTTTAGTGGTGTGAAGG + Intergenic
943582539 2:189701917-189701939 ATAGGCCTTTAATAATGTGATGG + Intronic
943824263 2:192368981-192369003 ATTTGCTTTAAGTATGGTGATGG + Intergenic
946578192 2:221099368-221099390 ATTTGTTTTTAGTAGAGTCAGGG + Intergenic
948683006 2:239649022-239649044 TTAATCTTTTTGTAGTGTGAGGG - Intergenic
1168732106 20:93526-93548 CCATGCTTTTAGTAGTATGAAGG - Intronic
1169987996 20:11468770-11468792 ATTTGCTTTTATAAATGTGAAGG + Intergenic
1171754007 20:29083786-29083808 TTGTGTTTTTAGTAGTGTCAGGG + Intergenic
1174249728 20:49209569-49209591 TTGTGCTTTTAGTAGTGACAGGG - Intergenic
1175437465 20:58963699-58963721 ATAGGCCTTTAGTAATGTGTTGG - Intergenic
1175454548 20:59102066-59102088 ATAGGCCTTTAGTACTGTGGTGG + Intergenic
1177384053 21:20385976-20385998 ATAGGCCTTTAGTGGTGTGATGG + Intergenic
1177621065 21:23593721-23593743 ATAAGCCTTTAGTAATGTGGTGG - Intergenic
1178042632 21:28656587-28656609 AGATGGTTTTAGTAGTAGGATGG - Intergenic
1178619893 21:34165067-34165089 GTATGTTTTTAGTAGTGACAGGG + Intergenic
1179220842 21:39405601-39405623 ATATGGTTTTAGTATTCTGTGGG - Intronic
1182898564 22:33878855-33878877 ATATGGTTTTAAAAGAGTGAGGG + Intronic
1183880444 22:40822574-40822596 ATATACTTTATGTAGTGTCAAGG - Intergenic
1184381857 22:44149708-44149730 ATATGCGTGTAGTGGTGGGACGG - Intronic
951696451 3:25450105-25450127 AAATGCTTAGAGTAGAGTGAAGG + Intronic
952635847 3:35529568-35529590 ATAGGCTTTTAGTAATGTGGTGG - Intergenic
954053596 3:48003674-48003696 TTACACTTTTATTAGTGTGATGG + Intronic
956177884 3:66490539-66490561 ATCTGGTTTTAGCAGTGTGGTGG - Intronic
958425766 3:93977302-93977324 ATATGCTTTCAGTAGTTAGATGG + Intergenic
958817912 3:98937240-98937262 AAATGGTTTTGGTAGTTTGATGG - Intergenic
959143274 3:102512338-102512360 ATATGTTTTTAGTAGAGACAGGG + Intergenic
960127752 3:114018955-114018977 ATTTGTTTTTAAAAGTGTGAGGG - Intronic
960664952 3:120099720-120099742 TTGTGTTTTTAGTAGAGTGAGGG + Intergenic
961376605 3:126470292-126470314 TTATGCTTTTAGTAGAGACAGGG - Intronic
963507049 3:146199441-146199463 ATATGCTTTTAGAATTGGAAGGG - Intronic
963519092 3:146342621-146342643 ATATGCTTTTAGAATTGGAAGGG - Intergenic
964852586 3:161110643-161110665 ATGTTCCTTTAGTAATGTGATGG - Intronic
965630875 3:170731274-170731296 AAATGCTTTTATTGGTGGGAAGG - Intronic
967186957 3:186952262-186952284 GTATGGTTTTGGTGGTGTGATGG - Intronic
969132952 4:5004909-5004931 ATGTGCCTTTAGGAGTTTGAGGG - Intergenic
970663252 4:18309399-18309421 ACAAGGTGTTAGTAGTGTGAAGG + Intergenic
971074327 4:23130256-23130278 ATATGCCTTTAGCAGTGTGGTGG - Intergenic
971129112 4:23786306-23786328 ATATGTTTTTAGTAGAGTTGGGG + Intronic
971998969 4:34004789-34004811 ATATGGTTTTAGTACTTTGTTGG - Intergenic
972092031 4:35298870-35298892 CTCTGCTTTTAGTATTGTGCAGG + Intergenic
972604172 4:40599080-40599102 ATTTGCTTTTAGTAGAGTTGGGG - Intronic
974462958 4:62212472-62212494 ATATGCTTTTATTAGTTTGGAGG - Intergenic
974525869 4:63049614-63049636 ATAGTCTTTTAGTAATGTGGTGG + Intergenic
974765609 4:66341736-66341758 ATTTGCTGGTAGTAGTGGGATGG - Intergenic
975967606 4:79993438-79993460 ATATGCTTTTAGGAGTGACAGGG - Intronic
976034701 4:80802318-80802340 ATATTGTTTTAGCAGTGTGTGGG + Intronic
978633060 4:110769411-110769433 TTAGGCTTTTAGTAATATGATGG + Intergenic
979014067 4:115409826-115409848 CTATGTTTTTAGTACTGTTAGGG + Intergenic
979388419 4:120098178-120098200 ATATGATTTTAGTATGGGGAGGG + Intergenic
979942166 4:126775145-126775167 AGAAGGTTTTAGTAGAGTGAAGG + Intergenic
980287157 4:130795368-130795390 ATATAGTTTTAGGAGTCTGAAGG + Intergenic
980947298 4:139334694-139334716 ATAGGCTTTTGCTTGTGTGAAGG + Intronic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
982373988 4:154667351-154667373 AGATGGTATTAATAGTGTGAAGG + Intronic
982922058 4:161288105-161288127 ATAGGCCTTTAGTAATGTGGTGG - Intergenic
983900821 4:173131956-173131978 ATATATTTTTAATACTGTGATGG - Intergenic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
984226522 4:177042123-177042145 AAATGTTTTTTGGAGTGTGATGG - Intergenic
984310280 4:178049496-178049518 TTATGCTTTTAGTAGAGACAGGG + Intergenic
987337355 5:16908601-16908623 ATCTGTTTTTATTAGTGTCATGG - Intronic
987853267 5:23384445-23384467 TTGTGCTTTAGGTAGTGTGAGGG - Intergenic
989475048 5:41865235-41865257 ATATGCTTTTATTTGTGGGCAGG - Intronic
991253247 5:64586584-64586606 ATATGCCATTATTAGTGTCATGG - Intronic
991542551 5:67745877-67745899 ATAGGCCTTTAGTGGTGTGGTGG - Intergenic
992921978 5:81534244-81534266 ATAGGCTTTCAGTAATGTGGTGG - Intronic
994555778 5:101301407-101301429 TTATGCTTTTAGAGGTGAGATGG - Intergenic
994617711 5:102127344-102127366 ATAGGATTTTAGTAATATGATGG + Intergenic
995637694 5:114213600-114213622 AAATGCTTTCAATAGTTTGAAGG - Intergenic
996233455 5:121095960-121095982 ATAGGCCTTTAGTAATGTGGTGG - Intergenic
996393501 5:122988899-122988921 ATATGCTATTATTTGTGTTATGG + Intronic
997218358 5:132134285-132134307 ATAGGCTTTTAGTAATGTAGTGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998150116 5:139752157-139752179 CTAAGCTTTGAGGAGTGTGAGGG - Intergenic
998705714 5:144757581-144757603 TTGTGCTTTTGGTAGTGGGAGGG + Intergenic
998705758 5:144757938-144757960 ATAGGCCTTTAGTAATGTGGTGG - Intergenic
1001740863 5:174051730-174051752 ATATGCTTTTATGTGTATGATGG - Intronic
1002669456 5:180854668-180854690 ATATGCTTTTAGTAGGGAGAAGG + Intronic
1008854665 6:56068413-56068435 ATATGCTTTTATTTGTTTGGAGG - Intronic
1009370265 6:62891599-62891621 ATATACTTTCAGTATTGTGAAGG + Intergenic
1011279541 6:85663125-85663147 ATATACTTTTAGTAGAGACAAGG - Intergenic
1011638677 6:89399597-89399619 ATATATTTTTAGTAGAGAGAGGG - Intronic
1011942856 6:92864607-92864629 ATAAGCCTTCAGTAATGTGATGG + Intergenic
1012327901 6:97946319-97946341 GAATGATTTTAGTAGAGTGATGG + Intergenic
1013402191 6:109809502-109809524 TAATGCTTTTAAGAGTGTGAAGG + Intronic
1015010024 6:128334765-128334787 ATATGCTTTTATTTGGGTGATGG - Intronic
1015267358 6:131302053-131302075 ACATCATTTTGGTAGTGTGATGG + Intergenic
1015613753 6:135053645-135053667 GTATGCTTTAACTAGAGTGAGGG - Intronic
1016708450 6:147141569-147141591 ATTTTCTTTTAAAAGTGTGAAGG + Intergenic
1020058368 7:5134223-5134245 ATATGCTTTTTGTAGAGTCAGGG + Intergenic
1020169251 7:5832346-5832368 ATATGCTTTTTGTAGAGTCAGGG - Intergenic
1021207360 7:17799657-17799679 ATGTGAATTTAGTTGTGTGATGG - Intronic
1021846668 7:24769649-24769671 ATAAGCTTTTAGTGATGTGGTGG - Intergenic
1025275004 7:57573857-57573879 ATATGGTTTTAGTACTTTGTTGG - Intergenic
1027817753 7:82998699-82998721 ATAGGCCTTTAGTAATGTGGTGG - Intronic
1027920589 7:84388713-84388735 ATATGTTTTTAGTAATTTGTAGG + Intronic
1028327784 7:89548402-89548424 ACATTCATTTAGTAGTGTCAAGG - Intergenic
1030835190 7:114275795-114275817 ATGGGCCTTTAGTAATGTGATGG + Intronic
1030965450 7:115988106-115988128 ATAAGCTGTTAGTAATGTGGTGG - Intronic
1031107237 7:117559697-117559719 ATATAATTTGGGTAGTGTGAAGG - Intronic
1032907511 7:136387477-136387499 ACATGATTTTATTAGTATGAGGG - Intergenic
1035427569 7:158790753-158790775 TTATGCTTTTAGTAGAGACAAGG - Intronic
1036204380 8:6794404-6794426 AGATACTTTTCGTAGTGTGGTGG + Intergenic
1040820920 8:51556097-51556119 ATATGTTTTTAGTAGAGACAGGG - Intronic
1041212141 8:55563355-55563377 ATAGGCCTTTAGTAATGTGTAGG + Intergenic
1041334799 8:56770059-56770081 ATAGGCCTTTAGTAATGTGGTGG + Intergenic
1041973479 8:63769857-63769879 AGCTGCTTTTACTAGTGTGAAGG + Intergenic
1043046991 8:75338988-75339010 ATAGGCCTTTAGTAATGTGGTGG + Intergenic
1044646874 8:94453027-94453049 ATATGCCTTTAGCATTTTGATGG - Intronic
1045620325 8:103970124-103970146 ATAGGCCTTTAGTAATGTGCTGG + Intronic
1047459554 8:125049384-125049406 ATATTTTTTTAGTAGAGTCAGGG - Intronic
1050273393 9:3970899-3970921 ATATGACTTTAGTATTCTGAGGG + Intronic
1050872919 9:10597372-10597394 ATATGCTTTGAGCACTGTCAGGG + Intronic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1054715192 9:68550616-68550638 ATATGCATTCAGTAGTCTTATGG + Intergenic
1058087125 9:100760355-100760377 ATATGGTTTTGGTAGTAGGAAGG + Intergenic
1061457839 9:130712381-130712403 TTATGCTTTTTGGAGGGTGAAGG + Intergenic
1203626275 Un_KI270750v1:27694-27716 ATATGGTTTTAGTACTTTGTTGG - Intergenic
1188231579 X:27670501-27670523 ACATCCTTTTAGTGTTGTGACGG + Intronic
1191142403 X:57130493-57130515 CTGAGCTTTTAATAGTGTGAGGG - Intergenic
1192380577 X:70612185-70612207 ATAGGCCTTTAGTAATGTGGTGG - Intronic
1195413153 X:104590808-104590830 ATAGGCTTTTAGTACTGTGAGGG - Intronic
1195475389 X:105279389-105279411 ATAAGCATTTACTAGTGGGAGGG - Intronic
1196312242 X:114182638-114182660 ATAGGCTTTTAGTAATGTGGTGG - Intergenic
1197342905 X:125294811-125294833 ATAGACTTTTAGTAGTGTCTTGG - Intergenic
1198210349 X:134510470-134510492 ATTTGCTTCTAGTATTGTCATGG - Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1201433955 Y:13936609-13936631 ATATCTTTTTAGTAGAGTGGGGG - Intergenic
1201559299 Y:15299473-15299495 AAATGCTCTTGGTAGTGTGGTGG - Intergenic
1202376484 Y:24242750-24242772 ATATACTTTTAAGAGTGTAAAGG + Intergenic
1202494296 Y:25427369-25427391 ATATACTTTTAAGAGTGTAAAGG - Intergenic