ID: 1052802305

View in Genome Browser
Species Human (GRCh38)
Location 9:32980393-32980415
Sequence TGCCAGAGCCACATTGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052802305_1052802316 28 Left 1052802305 9:32980393-32980415 CCTTGTCCAATGTGGCTCTGGCA 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1052802316 9:32980444-32980466 GTGAGAAGTGTGTAAAACTGAGG No data
1052802305_1052802310 6 Left 1052802305 9:32980393-32980415 CCTTGTCCAATGTGGCTCTGGCA 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1052802310 9:32980422-32980444 CCCCACACCCAGCCAGCTGGAGG 0: 1
1: 0
2: 10
3: 52
4: 555
1052802305_1052802308 3 Left 1052802305 9:32980393-32980415 CCTTGTCCAATGTGGCTCTGGCA 0: 1
1: 0
2: 1
3: 22
4: 138
Right 1052802308 9:32980419-32980441 CTTCCCCACACCCAGCCAGCTGG 0: 1
1: 0
2: 2
3: 50
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052802305 Original CRISPR TGCCAGAGCCACATTGGACA AGG (reversed) Intronic
901200961 1:7467174-7467196 AGCCAGAGCCAGGTTGGAGAAGG - Intronic
908031675 1:60006894-60006916 TGCAAGAGACACATAGGAAATGG - Intronic
909301165 1:74014898-74014920 GGACAGAGCCACCTTGGAGAAGG + Intergenic
912863232 1:113233690-113233712 TGCCAGGGTAACATTGGAGATGG - Intergenic
912932932 1:113980702-113980724 AGACAGAGCCACAATGGACTGGG - Intronic
915723440 1:158000930-158000952 TTCCAGAGCCAGATTGCAAAAGG - Intronic
918156148 1:181849010-181849032 TGTGAGAGCCACATGGGAAAGGG + Intergenic
924770943 1:247078822-247078844 TCCCAGCGCCCGATTGGACAGGG + Intergenic
1064516587 10:16155845-16155867 AGCCAGACCAACAGTGGACAGGG + Intergenic
1073348657 10:102803201-102803223 TGCCACTGCCACAGTGGAAAAGG - Intronic
1074211375 10:111338405-111338427 TGGCAGAGCCAAAGGGGACATGG - Intergenic
1074577086 10:114680520-114680542 TGCCAGAGCCACAGAGGATTGGG - Intronic
1076111781 10:127865289-127865311 TGGCAGAGACACATAGGACAAGG - Intergenic
1076183686 10:128430563-128430585 TGCCAGAGGGACACAGGACAGGG - Intergenic
1078435323 11:11320402-11320424 TACCATGGCCACATAGGACAAGG - Intronic
1080931073 11:36811711-36811733 TGGCAGAGCCATATGGGAAAAGG - Intergenic
1083323584 11:61862322-61862344 TGGCAGAGAGACAGTGGACAGGG + Intronic
1084012597 11:66360877-66360899 TGCCAGATCCACCTGGGACCAGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085686776 11:78630800-78630822 TGCAAGAGTCACATTGTACCTGG - Intergenic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1095544843 12:43354089-43354111 AGGCAGAGACATATTGGACATGG + Exonic
1096573273 12:52537039-52537061 TGTCAGTGCCACAAAGGACAGGG - Intergenic
1097770535 12:63579224-63579246 TGACAGAGCCCCATTATACATGG + Intronic
1098485263 12:71013916-71013938 TGCCAGGGCCATTTTGGTCATGG - Intergenic
1098859422 12:75690521-75690543 TGCCAAAGCCACCTCGGACTTGG - Intergenic
1102940951 12:116941197-116941219 TGCCTGGGCCCCATTGGCCAGGG + Intronic
1103322197 12:120098781-120098803 TGGCAGAGCCACAGTGGCCCAGG + Intronic
1104964645 12:132503430-132503452 GGCCAAGGCGACATTGGACATGG + Intronic
1108441327 13:50456267-50456289 GCCAAGAGCCACAGTGGACAAGG - Intronic
1112655126 13:101444238-101444260 TGACAGAGCCACATCACACAAGG + Intergenic
1113499795 13:110764259-110764281 TGCCAGAGCCACAGAGTCCAAGG + Intergenic
1113711065 13:112465964-112465986 GGCCAGAGCCACAGTGGAGCTGG - Intergenic
1113839522 13:113350885-113350907 TGCCAGCAGCACATTGTACAGGG + Exonic
1114678231 14:24459958-24459980 GGCCACAGCCACAGTGGAGATGG - Intergenic
1118680945 14:68241088-68241110 TCCCAGAGCCACATTTTAAAGGG - Intronic
1121513576 14:94533960-94533982 TGGCCGAGCCACATCTGACAAGG - Intergenic
1124063698 15:26319839-26319861 TCCCAGGTCCACATTGGAGAGGG + Intergenic
1125150417 15:36524494-36524516 TGACAGAGCCACATAGTAAAAGG + Intergenic
1126740169 15:51769313-51769335 TGCTAGAGCCATCCTGGACATGG - Intronic
1128066431 15:64767617-64767639 TGCCAGTCCCACCCTGGACATGG + Intronic
1128312358 15:66639118-66639140 TGCCAATGCCACCTAGGACAGGG + Intronic
1129693971 15:77730112-77730134 TGCCAGAGCCAAGAGGGACAGGG - Intronic
1130265878 15:82402687-82402709 GCCCAGAGCAACTTTGGACATGG + Intergenic
1130506142 15:84544199-84544221 GCCCAGAGCAACTTTGGACATGG - Intergenic
1130517522 15:84637347-84637369 TCCCAGAGCCACATCAGGCAGGG - Intergenic
1130925996 15:88386358-88386380 TGCCGGAGCCAAGCTGGACATGG - Intergenic
1133601365 16:7343118-7343140 TGCCAGAGCTGCATGGAACAGGG - Intronic
1135400432 16:22162890-22162912 CGCCAGACCCACCCTGGACATGG - Intergenic
1135720552 16:24814063-24814085 TGCCAGAGCCAGAGGGGAAATGG + Intronic
1135870204 16:26142817-26142839 TTCCAGAGCCACATATCACATGG + Intergenic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1138415405 16:56868561-56868583 TGGCAGAGGCACGCTGGACATGG + Intronic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1144810856 17:17998055-17998077 AGCTAGAGCCACACTGGACATGG + Intronic
1145051578 17:19666083-19666105 TGCCAGATCCAAATTGGAAATGG + Intronic
1147545685 17:41399585-41399607 AGCCAAAGCCACAGTGGAGATGG - Intergenic
1152365205 17:79851609-79851631 TGCCAGGGACACGTCGGACAAGG - Intergenic
1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG + Intronic
1157692471 18:49694802-49694824 GGCCAGAGACACATGGGACATGG + Intergenic
1159884201 18:73888703-73888725 TTCTAGAGCCACAGTGGACGAGG + Intergenic
1160889354 19:1369111-1369133 TGCCAGAGCCCCCTTTGTCAGGG + Intronic
1161572634 19:5038838-5038860 TGACAGCACCACATGGGACAGGG - Intronic
1161726593 19:5932953-5932975 TGCCAAAGGCAGATGGGACAAGG + Intronic
1167266944 19:48487931-48487953 GGACAGAGCCACATTGAGCAGGG + Intronic
927815784 2:26216178-26216200 TGTAAGAGCCACATTGGAGGAGG + Intronic
927970949 2:27306221-27306243 TGCCAGCTCCACCTTCGACATGG - Exonic
937407502 2:121644220-121644242 TGGCAGAGCCAGAATGCACAAGG + Intronic
937851710 2:126642147-126642169 TGCCAGAGCCACAGGGGTCTGGG - Intergenic
940866907 2:158826302-158826324 TGCCAGAGCCACGGGGGACAAGG + Intronic
944630672 2:201620628-201620650 TGCCAGTTGGACATTGGACAGGG + Exonic
948130837 2:235599603-235599625 TTCCGGAGCCACATGGGCCATGG - Intronic
948262423 2:236613937-236613959 TGCCAGAGGCACATTTTACATGG + Intergenic
1173330950 20:42075873-42075895 TGCCAGAGCCACTTGGAACAAGG - Exonic
1177890444 21:26798150-26798172 GGCCAGAGAAACAGTGGACATGG - Intergenic
1179275606 21:39889119-39889141 TGCCAGATCCACAGGGGACAAGG - Intronic
1180649146 22:17364436-17364458 TGCCAGAATCAAATTGGACCAGG - Intronic
1183670295 22:39268916-39268938 TGACAGAGCTACAAGGGACAGGG + Intergenic
1184876983 22:47282435-47282457 TGCCAGAGCTCCAGAGGACATGG + Intergenic
1184957915 22:47904438-47904460 TACCACTGCCACAATGGACATGG + Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
951910347 3:27743756-27743778 TGGGAGAGCCACTATGGACAGGG + Intergenic
951987413 3:28635994-28636016 TGCCAAAGCCACATGGAAGAGGG - Intergenic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
955739452 3:62074618-62074640 TGCATGAGCCACATTGCACCTGG + Intronic
956474653 3:69607582-69607604 TGCCAGAGTAAAATTGGACATGG - Intergenic
960811544 3:121631790-121631812 AGGCAGAGCCACTTTGGACATGG + Exonic
961176946 3:124843310-124843332 GGCCAGAGCCACATAGGCCAGGG - Intronic
961351471 3:126307271-126307293 TGATAGTGCCACACTGGACATGG - Intergenic
961475034 3:127140929-127140951 TGGCAGAGCCAGTGTGGACAGGG + Intergenic
961629567 3:128286232-128286254 TGCCAGAGCCACAAAGGGAAGGG - Intronic
965508315 3:169540479-169540501 TGACATGGCCACATTGAACATGG - Intronic
970068309 4:12124836-12124858 TGAAAGAGCCACCTTGGATATGG - Intergenic
970477341 4:16437006-16437028 TGCCTGTGTCACCTTGGACAAGG + Intergenic
971882551 4:32396732-32396754 TTCAAGAGCCACATTGTCCAAGG + Intergenic
973622862 4:52744741-52744763 TGACAGAGGCACATGGGAAATGG - Exonic
976816691 4:89156434-89156456 TGCAAGAGTCACACTGGAGATGG - Intergenic
979887728 4:126050954-126050976 TGGTATAGCCACTTTGGACATGG + Intergenic
984741986 4:183173748-183173770 ATCCAGAGCCACTTTGGACTTGG + Intronic
985682212 5:1261998-1262020 TGCCTGAGCCACAGTGAAAATGG - Intronic
986440620 5:7778359-7778381 TTCTAGAGACACATGGGACATGG + Intronic
986707635 5:10464475-10464497 TGACAGAGCCACCTGGGACATGG + Intronic
988832216 5:34999012-34999034 GGGCAGAGCCAAATTGTACAAGG - Intronic
991466919 5:66923300-66923322 TGCCAGACTCACATTGGGTATGG - Intronic
993200197 5:84806036-84806058 TGCCATAGCCACATGTGCCACGG + Intergenic
994451370 5:99949300-99949322 TGCCAGAGGCTCATAGAACATGG - Intergenic
997201677 5:132013478-132013500 TGCCAGAGCCGCATAGGGCCCGG - Intergenic
998092817 5:139380985-139381007 TGACAGAGACACAAGGGACAAGG + Intronic
998157153 5:139793510-139793532 TCCCAGAGCTACAAAGGACAGGG + Intergenic
999805652 5:155078710-155078732 TGCTAGAGCCATCTGGGACATGG - Intergenic
1000970354 5:167707484-167707506 TGCCACAAACACATTGGAAATGG - Intronic
1003253856 6:4457402-4457424 TGCCAGAGCCACAGAGGATGAGG + Intergenic
1004342329 6:14818634-14818656 TCCCAGAGGCACATTGCCCAGGG + Intergenic
1006059510 6:31410140-31410162 CACCACAGCCACACTGGACATGG + Intronic
1006072001 6:31505208-31505230 CACCACAGCCACACTGGACATGG + Intronic
1012409502 6:98940387-98940409 TGCTACAGCCACTTTGGAAATGG - Intronic
1014148157 6:118022082-118022104 TGCCAAAACCACATTGCAAATGG + Intronic
1014178326 6:118354335-118354357 TGCCAGACCAACATAGGATATGG + Intergenic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1018538258 6:164847519-164847541 TGCAAGAGGCATATTTGACATGG - Intergenic
1019179667 6:170178368-170178390 TGCCAGGGCCATGTTGGCCACGG + Intergenic
1020101277 7:5395450-5395472 GGCCAGGCCCACATCGGACAGGG + Intronic
1024821922 7:53341685-53341707 TGCCAAAGACACAATTGACAAGG - Intergenic
1027426082 7:78062609-78062631 TGACAAAGCCACATTGGACAGGG - Intronic
1029492542 7:100880067-100880089 TGCAGGAGCCACACTGGCCAAGG + Intronic
1029825908 7:103193918-103193940 TGACAGAGCCCCATTATACATGG + Intergenic
1031393464 7:121244674-121244696 TGCCAGAGCTGCAGTTGACAAGG - Intronic
1032033200 7:128501672-128501694 TCCCAGAGCCCCATTTAACAAGG + Intronic
1032442584 7:131953445-131953467 GGCCAGAGGCAAACTGGACAGGG - Intergenic
1034346451 7:150388284-150388306 ATCCATAGCCACATTCGACATGG - Intronic
1035340352 7:158156892-158156914 TTCCAGAGCCACATGGAACAGGG - Intronic
1035340364 7:158156949-158156971 TTCCAGAGCCACATGGTACAGGG - Intronic
1035340375 7:158157006-158157028 TTTCAGAGCCACATGGAACAGGG - Intronic
1035340407 7:158157177-158157199 TTCCAGAGCCACATGGAACAGGG - Intronic
1038022480 8:23562033-23562055 TTCCAGAGCCCCATTGAGCAGGG - Intronic
1043967795 8:86498438-86498460 TGTCAGAGACACAATGGAAAAGG + Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1046175072 8:110564967-110564989 TCCAAGAGCCTCATTGGAAAAGG + Intergenic
1047011045 8:120673022-120673044 AGCCAGAACCACAGTGGACCTGG - Intronic
1048333083 8:133484440-133484462 TGGCAGAGCCAACTTGGACCAGG + Intronic
1049072017 8:140363444-140363466 GTCCAGAGCCACAGTGGAGATGG + Intronic
1049333305 8:142067308-142067330 TGACAGTGCCTCAATGGACATGG - Intergenic
1050245245 9:3682397-3682419 TGCCAGATCTAAATTGGACCTGG - Intergenic
1050250473 9:3738496-3738518 TGCCAGACCCTCATTTGTCAGGG + Intergenic
1050710112 9:8451807-8451829 TGGCAGAGCCACAATGGGAAGGG - Intronic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1052802305 9:32980393-32980415 TGCCAGAGCCACATTGGACAAGG - Intronic
1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG + Intergenic
1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG + Intergenic
1054635284 9:67484519-67484541 TGCCAGTGCAAAATTGGACATGG - Intergenic
1054971752 9:71095890-71095912 TACCAGAGACAGAGTGGACATGG + Intronic
1056975330 9:91247506-91247528 TGCCAGAGCCCCATGTGTCAGGG - Intronic
1058556481 9:106174108-106174130 TGCCAGACCAACATGGGAAAAGG + Intergenic
1061623044 9:131824148-131824170 TGCCAGCGCCACTTTTGTCATGG + Intergenic
1186736340 X:12468890-12468912 TGCCAGTTTCACATTGTACAGGG + Intronic
1187095328 X:16141837-16141859 TGCCTGAGCCACATGTGATAAGG - Intronic
1198312817 X:135437435-135437457 CGCCAGGGCCACAGTGGACTAGG + Intergenic
1198715577 X:139554991-139555013 TGCAAGAGCCACAAGGGAAAGGG + Intronic
1200903915 Y:8461848-8461870 TCACAGAGCTACATTGGACAGGG - Intergenic
1202363828 Y:24140422-24140444 GCCCAGAGCAACTTTGGACATGG + Intergenic
1202506952 Y:25529700-25529722 GCCCAGAGCAACTTTGGACATGG - Intergenic