ID: 1052806725

View in Genome Browser
Species Human (GRCh38)
Location 9:33019997-33020019
Sequence TAGGACCTGACACGTGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052806721_1052806725 -2 Left 1052806721 9:33019976-33019998 CCACAGACGCTGCGTTTCTGCTA 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1052806725 9:33019997-33020019 TAGGACCTGACACGTGCGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 32
1052806717_1052806725 17 Left 1052806717 9:33019957-33019979 CCGCATTCCTGGCCCTTGGCCAC 0: 1
1: 0
2: 3
3: 52
4: 420
Right 1052806725 9:33019997-33020019 TAGGACCTGACACGTGCGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 32
1052806718_1052806725 10 Left 1052806718 9:33019964-33019986 CCTGGCCCTTGGCCACAGACGCT 0: 1
1: 0
2: 1
3: 13
4: 205
Right 1052806725 9:33019997-33020019 TAGGACCTGACACGTGCGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 32
1052806720_1052806725 4 Left 1052806720 9:33019970-33019992 CCTTGGCCACAGACGCTGCGTTT 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1052806725 9:33019997-33020019 TAGGACCTGACACGTGCGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 32
1052806719_1052806725 5 Left 1052806719 9:33019969-33019991 CCCTTGGCCACAGACGCTGCGTT 0: 1
1: 0
2: 1
3: 7
4: 67
Right 1052806725 9:33019997-33020019 TAGGACCTGACACGTGCGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052806725 Original CRISPR TAGGACCTGACACGTGCGGT GGG Intronic