ID: 1052807532

View in Genome Browser
Species Human (GRCh38)
Location 9:33025727-33025749
Sequence GCGCACGCGCACAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052807512_1052807532 26 Left 1052807512 9:33025678-33025700 CCGTCCGTGCTCGCTCGGGGTGG No data
Right 1052807532 9:33025727-33025749 GCGCACGCGCACAGGGAGGCAGG No data
1052807511_1052807532 27 Left 1052807511 9:33025677-33025699 CCCGTCCGTGCTCGCTCGGGGTG No data
Right 1052807532 9:33025727-33025749 GCGCACGCGCACAGGGAGGCAGG No data
1052807517_1052807532 22 Left 1052807517 9:33025682-33025704 CCGTGCTCGCTCGGGGTGGGGGG No data
Right 1052807532 9:33025727-33025749 GCGCACGCGCACAGGGAGGCAGG No data
1052807510_1052807532 28 Left 1052807510 9:33025676-33025698 CCCCGTCCGTGCTCGCTCGGGGT No data
Right 1052807532 9:33025727-33025749 GCGCACGCGCACAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052807532 Original CRISPR GCGCACGCGCACAGGGAGGC AGG Intronic