ID: 1052809491

View in Genome Browser
Species Human (GRCh38)
Location 9:33044541-33044563
Sequence CCCTCCAGCATTGAAGGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052809491_1052809502 7 Left 1052809491 9:33044541-33044563 CCCCAGCCTTCAATGCTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1052809502 9:33044571-33044593 CGTGGGGCTTCAGAAAGGCTAGG 0: 1
1: 0
2: 1
3: 7
4: 124
1052809491_1052809500 2 Left 1052809491 9:33044541-33044563 CCCCAGCCTTCAATGCTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1052809500 9:33044566-33044588 GGCCGCGTGGGGCTTCAGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1052809491_1052809498 -10 Left 1052809491 9:33044541-33044563 CCCCAGCCTTCAATGCTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1052809498 9:33044554-33044576 TGCTGGAGGGACGGCCGCGTGGG 0: 1
1: 0
2: 1
3: 18
4: 162
1052809491_1052809503 15 Left 1052809491 9:33044541-33044563 CCCCAGCCTTCAATGCTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1052809503 9:33044579-33044601 TTCAGAAAGGCTAGGCGCCGAGG 0: 1
1: 0
2: 0
3: 26
4: 379
1052809491_1052809499 -9 Left 1052809491 9:33044541-33044563 CCCCAGCCTTCAATGCTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1052809499 9:33044555-33044577 GCTGGAGGGACGGCCGCGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052809491 Original CRISPR CCCTCCAGCATTGAAGGCTG GGG (reversed) Exonic