ID: 1052809498

View in Genome Browser
Species Human (GRCh38)
Location 9:33044554-33044576
Sequence TGCTGGAGGGACGGCCGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052809491_1052809498 -10 Left 1052809491 9:33044541-33044563 CCCCAGCCTTCAATGCTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1052809498 9:33044554-33044576 TGCTGGAGGGACGGCCGCGTGGG 0: 1
1: 0
2: 1
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052809498 Original CRISPR TGCTGGAGGGACGGCCGCGT GGG Exonic