ID: 1052811574

View in Genome Browser
Species Human (GRCh38)
Location 9:33065572-33065594
Sequence CTTCTTCACCTTGTACAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052811574_1052811580 26 Left 1052811574 9:33065572-33065594 CCTAATTGTACAAGGTGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052811574 Original CRISPR CTTCTTCACCTTGTACAATT AGG (reversed) Intronic
900139064 1:1131823-1131845 CTTCTTCTCCTTGCACAAGACGG + Intergenic
907113006 1:51943872-51943894 CTGCTTCACCTTGCACTTTTAGG - Intronic
907537155 1:55174112-55174134 CTTCTTCACCTTTTACCTTCAGG - Intronic
908090178 1:60677601-60677623 CTTCTTCACCTTGTGGGATCAGG + Intergenic
908584477 1:65553486-65553508 TTTCTTCCGCTTGTTCAATTTGG + Intronic
909711374 1:78653113-78653135 TTTCTTCACGTTTTAAAATTTGG + Intronic
910556530 1:88540603-88540625 TTTCTTCTCCTTGTAACATTAGG + Intergenic
910664846 1:89713289-89713311 CTTCTTCACCTTCTCAAATAAGG - Exonic
911285007 1:95979756-95979778 TTTCTTTACCTTTTACATTTCGG + Intergenic
912178225 1:107186532-107186554 CTTCTTCCCTATGTACTATTAGG + Intronic
912377303 1:109220860-109220882 TTTCTTTACCTTTTACATTTAGG + Intronic
916414874 1:164583231-164583253 CAGCTTCACCTTTTAGAATTTGG + Intronic
916802208 1:168226075-168226097 CTTCTTCAGCTTGTCCATTGCGG - Exonic
917032349 1:170707310-170707332 CTCCTTCACTTTGTTCTATTTGG - Intronic
917372132 1:174305250-174305272 TTTCTGCACCTTGTAGAATTTGG - Intronic
918353621 1:183683937-183683959 TTTCTTCCGCTTGTTCAATTTGG + Intronic
919223313 1:194660250-194660272 TTTCTTCCACTTGTTCAATTTGG - Intergenic
920799762 1:209174934-209174956 CTGCTTCACCTTGTACTTTTAGG - Intergenic
921431780 1:215074091-215074113 CTTGATCACTTTGTACAATTTGG + Intronic
921508397 1:216002754-216002776 CTTCTTCACCACCTACAAGTTGG - Intronic
924730847 1:246710347-246710369 CCTCTTCACCTTCTACCATGAGG - Intergenic
1063001564 10:1929087-1929109 ATTCTGCACTTTGTACAATAAGG - Intergenic
1064062604 10:12151262-12151284 CTTCTTCACTTTATGAAATTGGG + Intronic
1064182699 10:13132995-13133017 CTTCTTTACCTTGTGCTGTTAGG + Intronic
1064366352 10:14712067-14712089 CTTCTTCACTTTGTAACCTTGGG - Intronic
1066419338 10:35249687-35249709 CTGCTTCACCTTGTACAGTAGGG + Intronic
1066582393 10:36895306-36895328 CTTATCCACCATGTTCAATTTGG - Intergenic
1066810002 10:39317978-39318000 CTTCTTCACCTTAGGCTATTTGG + Intergenic
1067340757 10:45401476-45401498 CTTATTCACTTTTTAAAATTTGG + Intronic
1068152978 10:53157719-53157741 CTTCCTCACCTTGTTCACTGTGG - Intergenic
1068430990 10:56931955-56931977 ATCCTTCCCCTTGTACAATTTGG - Intergenic
1071209508 10:83322425-83322447 CTTCTTCAGATTGTTCACTTTGG - Intergenic
1073132696 10:101200490-101200512 CCTCTTCACCTTCTGCACTTAGG + Intergenic
1074983476 10:118638106-118638128 CTTTTTCACCTAGTAGAATATGG + Intergenic
1075425917 10:122341630-122341652 CATTTCCCCCTTGTACAATTAGG - Intergenic
1077509729 11:2951791-2951813 CTTCTTCACCTTCTTCAAACTGG + Exonic
1077790262 11:5431485-5431507 TTTCTTCACCATGTACATTGTGG - Intronic
1078477293 11:11641884-11641906 CTGCCTCACCTTGCACAAATAGG + Intergenic
1082575761 11:54801400-54801422 CTTATTCACCATGATCAATTGGG + Intergenic
1086513974 11:87590332-87590354 TTTCTTCAGCTTGGTCAATTCGG - Intergenic
1087874079 11:103334967-103334989 ATTATTCACCTTGAAGAATTTGG + Intronic
1088510981 11:110574513-110574535 CTTTTTCACCTTGTATCACTAGG + Intergenic
1092382337 12:8007109-8007131 CTGCTTCACCTTGCACTTTTAGG - Intergenic
1093694914 12:22147875-22147897 TTTCTTCCACTTGTTCAATTCGG - Intronic
1094024161 12:25944946-25944968 CTTCTTTAATTTGTAAAATTGGG - Intergenic
1095939881 12:47719229-47719251 CTTGTTCACCTTGGACCATCAGG - Intronic
1097206555 12:57326571-57326593 CTGCTTCACCTTGCACCTTTAGG - Intronic
1097659789 12:62416915-62416937 CTTCTTCTCCATGTCAAATTTGG + Intronic
1097671964 12:62550653-62550675 CTGCTTCACCTTGTACTTGTAGG + Intronic
1103101043 12:118176153-118176175 CTTCTCCTCCTTGTGCAATGCGG - Intronic
1103303645 12:119947149-119947171 CATCTGCACCTCGTACCATTGGG + Intergenic
1106823038 13:33487842-33487864 CTTCTTCACCTTTTGCAATCTGG + Intergenic
1106856815 13:33862790-33862812 TTCCTTCTCCTTGTATAATTTGG - Intronic
1107347787 13:39481502-39481524 CTTCTTGACACTGTACAATCAGG + Intronic
1108113619 13:47103888-47103910 CTTCTTCTGCTTGATCAATTTGG - Intergenic
1111640567 13:90964373-90964395 CTGCTTCACCTTGAACTCTTAGG - Intergenic
1114161364 14:20171574-20171596 CCTCTTCACATTTTAAAATTGGG - Intergenic
1114739148 14:25076994-25077016 CTTCTTCAAATTGAACAGTTTGG - Intergenic
1115998966 14:39222785-39222807 CTTCTTCATCTCCTACAATGTGG - Intergenic
1116043077 14:39709581-39709603 CTTCTTTACCCTGTAGAATTTGG + Intergenic
1116192753 14:41681006-41681028 CTTCTTCTACTTGATCAATTTGG - Intronic
1128035416 15:64521025-64521047 CTTCTTTACTTTGTACAGGTGGG + Intronic
1128231815 15:66040546-66040568 CTTCCTCACCTTGTAGGACTTGG - Intronic
1128753880 15:70168147-70168169 CTCCTTCACCTTGAACACTATGG + Intergenic
1130265847 15:82402406-82402428 CTTCTTAAAATTGTCCAATTAGG + Intergenic
1131494811 15:92898695-92898717 CGTCTTTATTTTGTACAATTGGG + Intronic
1132683063 16:1151824-1151846 CTTCTTCACCCTGCACGATGTGG + Intergenic
1134248648 16:12558768-12558790 CTGCTTCAGGTTGTACAATGCGG - Intronic
1135183576 16:20295638-20295660 CTTCTGCACCTTCTGCATTTCGG + Intergenic
1137818310 16:51420526-51420548 CTTCTTTCCTTTGTTCAATTAGG + Intergenic
1137873788 16:51975923-51975945 CTTCTTCAACTAGAAAAATTGGG + Intergenic
1139728662 16:68923527-68923549 CTTCTTCACCGAGCCCAATTTGG + Intronic
1139870044 16:70100168-70100190 CATCTTCACATTGTACCATCGGG + Intergenic
1144099364 17:11930354-11930376 CTTCTTCATCTTGGAATATTAGG - Intronic
1145716033 17:27022413-27022435 CTTCTTCACATTTTAAAATTGGG - Intergenic
1146081563 17:29785024-29785046 ATTCTTCACCTTTGAAAATTTGG - Intronic
1148725359 17:49785703-49785725 GTTATTTTCCTTGTACAATTTGG - Intronic
1150682258 17:67293493-67293515 CTTCTTCCCCTTCTCCAACTGGG + Intergenic
1151377591 17:73701472-73701494 CTGCTTCACCTTGCACTTTTAGG + Intergenic
1151410860 17:73927610-73927632 CTGCTTCACCTTGCACTTTTAGG - Intergenic
1151793061 17:76322007-76322029 CTGCTTCACCTTGCACTCTTAGG - Intronic
1153569936 18:6460216-6460238 CTGCTTCACCTTGTACTTTTGGG - Intergenic
1156061147 18:33077833-33077855 CTTGTACACCTGGTAGAATTTGG - Intronic
1156861155 18:41837748-41837770 CTCTTTCACCTTGTGCAATGAGG + Intergenic
1159232532 18:65627891-65627913 CCTGTTCACCTTGTCTAATTAGG - Intergenic
1164355800 19:27427438-27427460 CTTATTCACCTTGATCAAGTGGG + Intergenic
1164436980 19:28239101-28239123 CTTCTCCAACCTGAACAATTTGG + Intergenic
1164715666 19:30388586-30388608 CTTCTTCAACTTCTTCACTTGGG + Intronic
1165266428 19:34666134-34666156 CCTCTGCACTTTGTACAATCTGG - Intronic
1165274056 19:34733205-34733227 CTTCCTCACTTTGCACAATCTGG - Intergenic
1168050979 19:53829739-53829761 CCTCATCAGCTTGTACAATGAGG + Intergenic
1168103397 19:54152975-54152997 CTTCTTCATCTTCTACTATCTGG + Exonic
928229276 2:29482389-29482411 CTCCTTCACCTTGAAGAAGTGGG - Intronic
931419377 2:62112091-62112113 CTTCTTAACCTTTTAAAATCTGG - Intronic
937235076 2:120426374-120426396 CTTCTCCACCTTGAAAAAATTGG - Intergenic
937607857 2:123823722-123823744 CTTCTACATCTAGTAGAATTCGG - Intergenic
943001992 2:182339638-182339660 CTTCTAAATCTTGAACAATTGGG + Intronic
943875984 2:193068124-193068146 CTTCATCATCTTTTTCAATTTGG + Intergenic
944333202 2:198497291-198497313 CTTCTTGACCCTATACACTTTGG + Intronic
944927680 2:204481695-204481717 ATTCTTCACCTTCTTCAATTTGG + Intergenic
945423669 2:209671357-209671379 CTTCTACTCCTTGCTCAATTTGG - Intronic
946419154 2:219555130-219555152 GTTATTCACCTTGTACAGCTGGG - Intronic
946583627 2:221159058-221159080 CCTCTTCAGCCTGTACAGTTTGG - Intergenic
948342098 2:237261786-237261808 ATTCTTCAGCTTGTACAGTTGGG - Intergenic
1170471570 20:16673237-16673259 CTTCTTTATCTTAAACAATTAGG - Intergenic
1171082421 20:22200550-22200572 CTTTTACACCTAGTAGAATTTGG - Intergenic
1173751011 20:45476946-45476968 CTTCTTCTGCTTGATCAATTCGG + Intronic
1177103494 21:16924734-16924756 TTTCTTCATCTTGTACATATAGG - Intergenic
1177531513 21:22363992-22364014 CTTCTTCACCTTGTGTAATCAGG + Intergenic
1182228474 22:28818474-28818496 CCTCCTCACTTTGTACAATGAGG + Intergenic
949677107 3:6468168-6468190 CTTCTTCACATTTTATAGTTAGG - Intergenic
949685196 3:6561683-6561705 TTTCTTAACCTTTTCCAATTTGG + Intergenic
949908896 3:8883776-8883798 ATTCTTCAGCTTTTACCATTAGG + Intronic
951556567 3:23926702-23926724 CTTCTACAGTTTGTACCATTGGG - Intronic
952078151 3:29723847-29723869 CTTCTTAAACTCATACAATTGGG - Intronic
952251224 3:31657083-31657105 GTTCTTTACGTTGTAAAATTAGG - Intergenic
955100394 3:55843510-55843532 CTTCTTGAACTTGCACCATTGGG - Intronic
956937178 3:74116278-74116300 CTCCCTCACCTTGTTCAGTTAGG - Intergenic
958598615 3:96263668-96263690 CTTGTTCACCATGAACAAGTGGG + Intergenic
958954498 3:100452557-100452579 CTCATTCCCCTTTTACAATTTGG + Intronic
959726442 3:109547753-109547775 TTTATTCATCTGGTACAATTTGG + Intergenic
960525650 3:118706718-118706740 CTTCTTCACCTGAGACAGTTTGG - Intergenic
961204155 3:125067651-125067673 CCCCTTCACCTTCTACAATCCGG - Intergenic
962115989 3:132508262-132508284 CTGCTTCACCTTGCACTTTTAGG - Intronic
964812198 3:160677756-160677778 CTTCTTCACTTTGAACATTCTGG - Exonic
965358388 3:167707081-167707103 CTGCTTCACGTTGTACATGTAGG - Intronic
967400278 3:189053176-189053198 CTGCTTCACCTTGCACTTTTAGG + Intronic
967720224 3:192808339-192808361 CTTCTTCCTCTTGTGCATTTTGG - Intronic
971799557 4:31270939-31270961 CTTCTTCACTTTCTAGCATTAGG + Intergenic
972694662 4:41433885-41433907 CTCCCTCTACTTGTACAATTTGG - Intronic
973055691 4:45654962-45654984 CTTATTCACCATGTTCAAGTGGG + Intergenic
973817457 4:54632013-54632035 CTTCTTCCCATTGTATGATTTGG + Intergenic
974347402 4:60699610-60699632 CTTCTTCACCATGATCAAGTGGG + Intergenic
977060416 4:92252374-92252396 CTTATTCACCATGAACAAGTAGG - Intergenic
978096057 4:104780013-104780035 CTTCTTCCAGTTTTACAATTTGG + Intergenic
978423142 4:108555185-108555207 CTTCTTCACTTTGTGTGATTTGG - Intergenic
980182736 4:129422037-129422059 CTTCTTCTTCTTGTGTAATTGGG - Intergenic
981671694 4:147293842-147293864 TTTCTTCTGCTTGTTCAATTTGG - Intergenic
982457700 4:155629777-155629799 CTTTTTCACATTGTTCATTTGGG + Intergenic
983030961 4:162801405-162801427 TTTCTTCATCATTTACAATTTGG + Intergenic
983193447 4:164779598-164779620 CTTCTTAATTTTGGACAATTTGG - Intergenic
983300931 4:165924580-165924602 CTGCTTCACCTTGCACTTTTAGG - Intronic
983694114 4:170507653-170507675 CTTGTACATCTTGTAGAATTCGG + Intergenic
984795570 4:183657549-183657571 CATCTTCAACTTCTACATTTAGG - Intronic
987322334 5:16782149-16782171 CTTCTTCAGTTTCTAGAATTGGG - Intronic
987544516 5:19295674-19295696 TTGCTTCACCTTGCACATTTAGG - Intergenic
988880099 5:35493002-35493024 ACTCTTCACTTTGAACAATTGGG + Intergenic
993317632 5:86431140-86431162 CTTCTGTACCATCTACAATTTGG - Intergenic
994598365 5:101868690-101868712 ATTCTTCACCTTTAACAGTTTGG + Intergenic
995111995 5:108438554-108438576 TTTCTTCATCTTGATCAATTTGG - Intergenic
995475183 5:112540326-112540348 TTTCTTCGCCTTGATCAATTCGG - Intergenic
995539455 5:113170330-113170352 CATCCTCTCCTTGTAGAATTGGG + Intronic
996352012 5:122554352-122554374 CTGCTTCACCTTTTACTTTTAGG - Intergenic
996856820 5:128017459-128017481 CTTCTTAAACTTCTACACTTGGG + Intergenic
997666427 5:135633109-135633131 CATCTTCCCCTTGTACAGATTGG - Intergenic
999723595 5:154417079-154417101 CCTCTTCACCCTGAACCATTTGG - Exonic
1001369696 5:171186342-171186364 CTGCTTCACCTTGCACTCTTAGG + Intronic
1001708026 5:173756113-173756135 CTTCTTCAACTTGTCCGAGTGGG + Intergenic
1002572212 5:180147373-180147395 GCTCTTTACATTGTACAATTAGG + Intronic
1005188036 6:23184610-23184632 ATTTTTGACCTTGTAAAATTTGG - Intergenic
1007569145 6:42876775-42876797 CCTCTTCATCATGTACATTTGGG - Intergenic
1009336208 6:62493391-62493413 TTTCTTCAGCTTGATCAATTCGG - Intergenic
1011966834 6:93169467-93169489 ATTCTTCACCATGGATAATTTGG - Intergenic
1012561164 6:100583174-100583196 CTTGTACCTCTTGTACAATTCGG + Intronic
1013088777 6:106879960-106879982 CTGCTTCACCTTGCACTTTTAGG + Intergenic
1014484622 6:121983984-121984006 TTTCTTCCCCTTGGTCAATTCGG + Intergenic
1014938220 6:127408946-127408968 CTTATTCACCATGATCAATTTGG - Intergenic
1016891583 6:149012995-149013017 CTTCTTCATCTGGTAAAATGAGG - Intronic
1017232577 6:152089451-152089473 CTTATTCACTTTATGCAATTTGG - Intronic
1017543976 6:155431802-155431824 CTTTATGACCTTGGACAATTTGG - Intronic
1020815639 7:12902091-12902113 TTCATTCACCTTGTAAAATTAGG - Intergenic
1022031580 7:26496306-26496328 CTTTTTCACTTATTACAATTAGG + Intergenic
1022170798 7:27827829-27827851 CTTCTTTACTTTGTAGAATTTGG + Intronic
1023095312 7:36654322-36654344 CTTCTTCTTCTTGTACCAGTGGG + Intronic
1025007347 7:55364903-55364925 CTTCATCACCTAGTACCATTTGG + Intergenic
1028234065 7:88338912-88338934 CTTCTTCAACTTTTAAAAATTGG - Intergenic
1030801478 7:113857637-113857659 TTTCTTCCCCTTGATCAATTTGG - Intergenic
1032673851 7:134110178-134110200 CTTCTTCACCTTAGACACTTTGG + Intergenic
1033861888 7:145638606-145638628 CCTCTTCACCTTTTAAAATAAGG + Intergenic
1033924941 7:146446370-146446392 CTTCTACACATTCTACAATATGG + Intronic
1034459549 7:151190992-151191014 CTTCTTCTCCTTGTCCAGCTTGG + Exonic
1038026207 8:23592965-23592987 CTTCTTCACCTTGACAATTTGGG + Intergenic
1039875624 8:41582410-41582432 TTTCTTCACCTTGGAGAAATAGG + Intronic
1043157338 8:76800126-76800148 CTCCTTCACTTTGTACCTTTTGG - Intronic
1045465516 8:102466050-102466072 CTGCTTCACCTTGTACTTTTAGG + Intergenic
1045839491 8:106562340-106562362 TTTCTTCAGCTTGATCAATTTGG - Intronic
1046168576 8:110473587-110473609 CTGCTTCACCTTGAACTTTTAGG + Intergenic
1046752804 8:117942833-117942855 TTTATTCAACTTGTAGAATTAGG - Intronic
1050233732 9:3556242-3556264 ATTTTTCCACTTGTACAATTAGG + Intergenic
1050417425 9:5432357-5432379 CTTCTTACCTCTGTACAATTAGG + Intronic
1050681327 9:8115066-8115088 TTTTGTCACCTGGTACAATTTGG - Intergenic
1052811574 9:33065572-33065594 CTTCTTCACCTTGTACAATTAGG - Intronic
1058057915 9:100467938-100467960 CTTCTTCACCTTGTGGCCTTGGG + Intronic
1058328706 9:103730717-103730739 CTTTTTCACCTGGAGCAATTTGG - Intergenic
1185730602 X:2458232-2458254 CGTCTTCACTTTGTACAAGGTGG - Intronic
1186231551 X:7460491-7460513 CTTCTTCAACATATATAATTAGG + Intergenic
1186589812 X:10918033-10918055 CTTCATCACCTTTTTCATTTTGG - Intergenic
1189866819 X:45339074-45339096 CTTATCCACCATGAACAATTAGG + Intergenic
1191799788 X:65065914-65065936 CTTCTTCTGCTTGATCAATTTGG + Intergenic
1191919236 X:66236698-66236720 TTTGTACACCTTGTAGAATTGGG + Intronic
1192927576 X:75771529-75771551 CTTGTACCCCTTGTAGAATTCGG + Intergenic
1193523074 X:82554089-82554111 CTTTTTCACCATGTAAATTTGGG + Intergenic
1194100404 X:89696515-89696537 CTGCTTCACCTTGCACTTTTAGG + Intergenic
1194252192 X:91589626-91589648 CTTCTTCACCATGATCAAGTTGG + Intergenic
1194529576 X:95028774-95028796 CTTGTACATCTTGTAGAATTTGG - Intergenic
1195070869 X:101277986-101278008 CTTCGTCAGCATGTACAAATGGG + Intronic
1195397707 X:104429137-104429159 GTACTTTACCTTGTATAATTGGG + Intergenic
1197416482 X:126180223-126180245 CCTCTTCTCTTTGTACAAATTGG + Intergenic
1200453408 Y:3357876-3357898 CTGCTTCACCTTGCACTTTTAGG + Intergenic
1200571119 Y:4830866-4830888 CTTCTTCACCATGATCAAGTTGG + Intergenic
1201079016 Y:10215971-10215993 CTTGTACATCTTGTAGAATTCGG + Intergenic
1201785199 Y:17768839-17768861 ATTTTTCACCTAGTACATTTTGG - Intergenic
1201816354 Y:18137148-18137170 ATTTTTCACCTAGTACATTTTGG + Intergenic