ID: 1052811578

View in Genome Browser
Species Human (GRCh38)
Location 9:33065601-33065623
Sequence GTAGTTTGGCTTGCTTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052811578_1052811582 3 Left 1052811578 9:33065601-33065623 CCACAAGAAGCAAGCCAAACTAC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1052811582 9:33065627-33065649 GCAAAACTCCAAAAAGGCTTAGG No data
1052811578_1052811580 -3 Left 1052811578 9:33065601-33065623 CCACAAGAAGCAAGCCAAACTAC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG No data
1052811578_1052811583 9 Left 1052811578 9:33065601-33065623 CCACAAGAAGCAAGCCAAACTAC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1052811583 9:33065633-33065655 CTCCAAAAAGGCTTAGGAACTGG No data
1052811578_1052811585 12 Left 1052811578 9:33065601-33065623 CCACAAGAAGCAAGCCAAACTAC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1052811585 9:33065636-33065658 CAAAAAGGCTTAGGAACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052811578 Original CRISPR GTAGTTTGGCTTGCTTCTTG TGG (reversed) Intronic
903905463 1:26682793-26682815 GGACTGTGGCTTCCTTCTTGAGG + Intergenic
905601831 1:39258893-39258915 GTGCTTAGGCTTGTTTCTTGAGG + Intronic
906853321 1:49277352-49277374 GCAGTTTGGCTGGGTTCATGGGG + Intronic
907819660 1:57954480-57954502 GTAGCCTCGCTTTCTTCTTGAGG - Intronic
907919072 1:58896257-58896279 GTACTTAGGCCTGCTTCCTGGGG - Intergenic
908864104 1:68526462-68526484 GTAGTTTGGCTTGGTGCTAATGG + Intergenic
910651447 1:89572663-89572685 GTATTATGGCTTGCTTACTGTGG + Intronic
912490641 1:110060907-110060929 GGAGTGTGGCTGGCTTCATGGGG - Exonic
916323139 1:163528194-163528216 GTAGTTTGTTTTACTTTTTGAGG - Intergenic
918379035 1:183936554-183936576 GAAGTTTGGGTTGATTTTTGTGG - Exonic
919489563 1:198188624-198188646 GTAGTTTTGTCTGCTTCTTGAGG + Intronic
1065522990 10:26589925-26589947 GAAGTTTGGCTGGGTTCTGGTGG - Intergenic
1072849184 10:98868964-98868986 GTATTTAGACTTGCTTTTTGTGG + Intronic
1072853693 10:98924574-98924596 GTACTTTGTCTTACATCTTGTGG - Intronic
1074791425 10:116891672-116891694 GTAGTTTTGATTGTTTCTTTTGG + Intronic
1075074346 10:119340920-119340942 GTAGTTTTCCTGTCTTCTTGGGG + Intronic
1076632179 10:131857851-131857873 TCAGTTTGACTTGCTTCTTCTGG - Intergenic
1076665338 10:132085930-132085952 CTTGTTTTGCTAGCTTCTTGAGG + Intergenic
1078873450 11:15370896-15370918 CTAGTTTGTTTTGCCTCTTGGGG + Intergenic
1082080922 11:48012067-48012089 GTAGTTCGGATGGCTTCTTGTGG + Intronic
1083136790 11:60686116-60686138 ATTGTTTGGCTTGCCTGTTGGGG - Intergenic
1091430908 12:433548-433570 GTGTTTTAGCTTGCTTCTGGTGG + Intronic
1097988420 12:65808704-65808726 GTATTTCTGCTTGCTGCTTGAGG - Intergenic
1098214102 12:68197697-68197719 GTAATTTTGTTTGCTGCTTGAGG - Intergenic
1101879252 12:108615123-108615145 ATTGGTTTGCTTGCTTCTTGGGG + Intergenic
1107579464 13:41766811-41766833 GTAGACAGGCTTGCTCCTTGAGG + Intronic
1110738969 13:78972154-78972176 AAAGTTTGGTTTGCTTCCTGAGG - Intergenic
1114573276 14:23690528-23690550 CTATTTTGGCTTGCCTTTTGTGG + Intergenic
1114874416 14:26697987-26698009 ATATGTTGGCTTGCTTCTGGGGG + Intergenic
1117185770 14:53239157-53239179 GTATTTTGGATTGGTTATTGAGG + Intergenic
1121097004 14:91224434-91224456 ATAGTTTGGGCTGCTTCTTTTGG - Intronic
1121956758 14:98220321-98220343 GGAGTTTTGCCTACTTCTTGTGG - Intergenic
1124707428 15:31977576-31977598 GCAGTTTGCCTTCCTTCCTGGGG + Intergenic
1126315954 15:47370064-47370086 TGAGTTTGGCTTGTTTCTTCTGG + Intronic
1126427844 15:48548750-48548772 GGTGTTTGGCTTCCCTCTTGGGG - Intronic
1128680637 15:69648863-69648885 GTTGTCAGGCTTGCTTTTTGAGG + Intergenic
1131550984 15:93356899-93356921 GTAGGTTGGCTTCCTTCTGATGG - Intergenic
1133922184 16:10163266-10163288 GTGCTTTGGCTTGTCTCTTGTGG - Intronic
1134582111 16:15379255-15379277 TTTGTTTTGCTTGCTTCTTAGGG - Intronic
1134712606 16:16334951-16334973 TTTGTTTTGCTTGCTTCTTAGGG + Intergenic
1134954221 16:18373742-18373764 TTTGTTTTGCTTGCTTCTTAGGG - Intergenic
1135313045 16:21420658-21420680 TTTGTTTTGCTTGCTTCTTAGGG - Intronic
1135365969 16:21852938-21852960 TTTGTTTTGCTTGCTTCTTAGGG - Intronic
1135445846 16:22518224-22518246 TTTGTTTTGCTTGCTTCTTAGGG + Intronic
1136323157 16:29501166-29501188 TTTGTTTTGCTTGCTTCTTAGGG - Intronic
1136437841 16:30241134-30241156 TTTGTTTTGCTTGCTTCTTAGGG - Intronic
1137344553 16:47643854-47643876 GTAGTGTGATTTGCTTCATGGGG + Intronic
1141752857 16:85970663-85970685 CTAGTTGGGGTTGCTTTTTGGGG + Intergenic
1144725257 17:17498627-17498649 GGAAGTTGGCTTGCTGCTTGAGG - Intergenic
1149276970 17:55052154-55052176 GTAGCCTGGCTTTCTTCTAGTGG - Intronic
1150341857 17:64374794-64374816 TTTGTTTGGCTTGGTTTTTGGGG - Intronic
1152782619 17:82232890-82232912 GTGGGTTGGCATGCTTCCTGGGG + Intronic
1152869496 17:82744459-82744481 GTAGATTAGTTTGCATCTTGTGG + Intronic
1153475617 18:5495486-5495508 GGTGCTTGGCTTGCTTCTTGAGG - Intronic
1154118843 18:11635013-11635035 TTTGTTTTGCTTGCTTCTTAGGG - Intergenic
1155597101 18:27500852-27500874 CTTGTTTGGCCTGATTCTTGGGG + Intergenic
1156781490 18:40855993-40856015 GTTGTTTTGCGTGTTTCTTGTGG + Intergenic
1158031708 18:52973659-52973681 GCAGACTGACTTGCTTCTTGTGG + Intronic
1159212838 18:65349316-65349338 GCAGTTTGCATTGCTTTTTGGGG - Intergenic
1160269934 18:77374396-77374418 GTACTTTTGCTTCCTTATTGGGG + Intergenic
1166960822 19:46495009-46495031 GCAGGCTGGCTCGCTTCTTGGGG - Exonic
927146305 2:20168697-20168719 GCAGCTTGGGTTGCTTCCTGAGG + Intergenic
928848687 2:35714168-35714190 GTAGTTTAGCTTTCATGTTGAGG + Intergenic
929837750 2:45422928-45422950 GTAGTTGGGCTTGCCTCTGTAGG - Intronic
930744173 2:54863745-54863767 GAATTTTTGCTTGTTTCTTGTGG + Intronic
934746483 2:96762817-96762839 GTAGAGAGGCTTGCTGCTTGAGG + Intronic
935994339 2:108752431-108752453 GTAGTTTGGATTGCTACGTTAGG + Intronic
939497612 2:142942780-142942802 GTATTTTGGCATGCTTCTGGAGG + Intronic
941862666 2:170300120-170300142 GTATTCTGGCTTTCTTCTTTGGG + Intronic
942983229 2:182106900-182106922 GGGGTGTGGCTTGCTTCTTCTGG - Intronic
943579423 2:189667519-189667541 GCAGTCTGGTTTGCTTCTAGAGG + Exonic
945886758 2:215384036-215384058 GGAAATTGGCTTGCTGCTTGCGG + Exonic
946994406 2:225374828-225374850 GCAGTTTGGCTGGCTTGTTTGGG + Intergenic
947118364 2:226795240-226795262 ACAGTTTGGCTGGCTCCTTGGGG + Exonic
947517419 2:230818563-230818585 TGAGTTTGGCCTGGTTCTTGAGG - Exonic
1168953671 20:1819577-1819599 TGAGTTTGGCTGGCTTGTTGAGG - Intergenic
1169859865 20:10140084-10140106 ATAATTTGCCTTGATTCTTGAGG - Intergenic
1175328751 20:58148221-58148243 GAAGTGGGGTTTGCTTCTTGAGG - Intergenic
1185208530 22:49553874-49553896 GCAGCTGGGCTGGCTTCTTGCGG - Intronic
1185407947 22:50666292-50666314 GTAGTGTGGCTTTCTTCTCAAGG + Intergenic
952507598 3:34021567-34021589 GTAGTTTTGCCTGCTCCTTTGGG - Intergenic
953428995 3:42821321-42821343 GTGGTTTTTCTTGCTTCTAGTGG - Intronic
961134522 3:124497326-124497348 GTATTTTGGCCTGCTCCTTCAGG + Intronic
962634792 3:137319509-137319531 TTAGTTTGACGGGCTTCTTGGGG + Intergenic
965190595 3:165523174-165523196 GTTGTTTCGCTAGCTTCTTGAGG - Intergenic
966823971 3:183948019-183948041 GTGGTTTAGCTTGCTTCTCCTGG - Intronic
967827141 3:193886045-193886067 ATAGTTTGGCCTGCTTCCAGTGG - Intergenic
972294354 4:37722337-37722359 GTAGTTTGGCTTATTTTCTGAGG - Intergenic
981174806 4:141668545-141668567 GGAGTTTGGCTGGGTTGTTGGGG + Intronic
982177401 4:152718830-152718852 GTAGCTTGGCTTTGTTCCTGTGG - Intronic
982201675 4:152967571-152967593 ATATATTGCCTTGCTTCTTGTGG + Intronic
982734283 4:158989193-158989215 GTAGTTTGTAGTTCTTCTTGAGG - Intronic
985031873 4:185797473-185797495 GTAGTTTGGGTTAATTCTTTAGG - Intronic
991160756 5:63499138-63499160 GTAGTATAGCTTGCTTTTTCAGG - Intergenic
992555314 5:77897324-77897346 GAAGGTGTGCTTGCTTCTTGGGG - Intergenic
994011315 5:94906137-94906159 GTAGTTTTGGTGGCTTGTTGGGG + Intronic
994304281 5:98183308-98183330 CTTGTTTGTCTAGCTTCTTGAGG - Intergenic
994601880 5:101915779-101915801 GGAGTTTCGCTGGCTTCTTTCGG - Intergenic
994977564 5:106829522-106829544 GAAGTTTAGCCTGCTTCCTGAGG - Intergenic
1000883697 5:166726443-166726465 GTTGTTTTGCTTCCTTCTTGTGG - Intergenic
1000958815 5:167574502-167574524 TTTGTTTGGCTTGGATCTTGTGG + Intronic
1008863781 6:56185145-56185167 GTAGTTTTTCTAGCTTCTTAAGG - Intronic
1012550369 6:100459486-100459508 GCTGTTTTTCTTGCTTCTTGGGG - Intronic
1013077400 6:106783457-106783479 GTAGTTTTCCTGGCTTGTTGTGG + Intergenic
1014182604 6:118401759-118401781 GTGTTTTGGAGTGCTTCTTGTGG + Intergenic
1016288449 6:142500948-142500970 GCAGTGTGGCTTGTTTCTTCAGG - Intergenic
1017823884 6:158067811-158067833 GTAGCCTGGGTTGCTGCTTGTGG + Intronic
1020070442 7:5223667-5223689 GTAGCCTGGCTTCCTTCTTGAGG + Intronic
1021230830 7:18085431-18085453 GTAGTCTGGCTTTATTCCTGAGG + Intergenic
1021303338 7:18999865-18999887 ACAGTTTGGCTTGTTTCTTTTGG - Intronic
1024087065 7:45902402-45902424 GTCCTTTGGCTTGCCTCTTCTGG - Intergenic
1027941285 7:84684218-84684240 GTAGTTTGGTTTTCATTTTGGGG - Intergenic
1028238354 7:88388106-88388128 GTAGTTTGTCTTCCTCCGTGAGG - Intergenic
1028263438 7:88692834-88692856 GTAGTCTTGCTTGGTTCTGGAGG - Intergenic
1029505996 7:100964610-100964632 GCACTTTGGGTTGCTTCTGGAGG + Intronic
1030133418 7:106222304-106222326 GTAGCTGGTGTTGCTTCTTGGGG - Intergenic
1031648010 7:124251417-124251439 TTAGTTTTGCTTGCTATTTGTGG - Intergenic
1036241810 8:7088015-7088037 GTCATCTGGCTTGGTTCTTGGGG - Intergenic
1038291218 8:26251491-26251513 GAAGGTTGGCTTGCTCCTAGAGG + Intergenic
1038501161 8:28045203-28045225 GTGATTTGGCTTGCTTCTAGTGG - Intronic
1041550797 8:59098695-59098717 GCTGTTTGGCTTGCTCCTTCAGG + Intronic
1045702172 8:104879808-104879830 GTAGTTTGGAGTTCTACTTGTGG - Intronic
1046436705 8:114198936-114198958 GGAGTTAGGCTTGTTCCTTGTGG + Intergenic
1050045497 9:1540141-1540163 CCAGTTTGGCTTGTTTCCTGCGG - Intergenic
1052811578 9:33065601-33065623 GTAGTTTGGCTTGCTTCTTGTGG - Intronic
1057541417 9:95975673-95975695 TTGGTTTGGCTTTCTTCTTCAGG + Intronic
1058194022 9:101952299-101952321 CTGGTTGGGCTTGCTTCTTTGGG - Intergenic
1059545545 9:115172361-115172383 GAAGTTTGGCTTGCATCTGGAGG - Intronic
1060104950 9:120867896-120867918 GCAGTTGAGCTTGCTTCTTTGGG - Intronic
1062445827 9:136593971-136593993 GTTGTTTGGTTTTCTTCTTGTGG - Intergenic
1185881804 X:3747940-3747962 GTAGCCTGGATTGCTTCTTGTGG - Intergenic
1189717838 X:43883216-43883238 GTAACTTGGCTTGCTGCTTCTGG - Intergenic
1198432960 X:136586344-136586366 CTATCTTGGCTTGCTTCTTTAGG + Intergenic
1200424267 Y:3004662-3004684 GTAGTTGGGCTTCCTTGTTTGGG - Intergenic
1200783191 Y:7235398-7235420 GTAGCTTGGGTTGCTTCTTCTGG + Intergenic