ID: 1052811580

View in Genome Browser
Species Human (GRCh38)
Location 9:33065621-33065643
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052811578_1052811580 -3 Left 1052811578 9:33065601-33065623 CCACAAGAAGCAAGCCAAACTAC 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG No data
1052811574_1052811580 26 Left 1052811574 9:33065572-33065594 CCTAATTGTACAAGGTGAAGAAG 0: 1
1: 0
2: 0
3: 16
4: 196
Right 1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr