ID: 1052814011

View in Genome Browser
Species Human (GRCh38)
Location 9:33085766-33085788
Sequence ATCCCGCGCGTGGCTCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052814001_1052814011 13 Left 1052814001 9:33085730-33085752 CCAATGGCCTTAGTAAATGGCAC No data
Right 1052814011 9:33085766-33085788 ATCCCGCGCGTGGCTCGGGGGGG No data
1052814003_1052814011 6 Left 1052814003 9:33085737-33085759 CCTTAGTAAATGGCACACCAGGA No data
Right 1052814011 9:33085766-33085788 ATCCCGCGCGTGGCTCGGGGGGG No data
1052813998_1052814011 30 Left 1052813998 9:33085713-33085735 CCTAATACTATACTTTTCCAATG No data
Right 1052814011 9:33085766-33085788 ATCCCGCGCGTGGCTCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052814011 Original CRISPR ATCCCGCGCGTGGCTCGGGG GGG Intergenic
No off target data available for this crispr