ID: 1052820382

View in Genome Browser
Species Human (GRCh38)
Location 9:33133835-33133857
Sequence ATTGAGATGCCCACTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052820382_1052820391 27 Left 1052820382 9:33133835-33133857 CCTACCCCAGTGGGCATCTCAAT 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1052820391 9:33133885-33133907 GCCTTAAGGTCCCTGCTCACTGG No data
1052820382_1052820387 -5 Left 1052820382 9:33133835-33133857 CCTACCCCAGTGGGCATCTCAAT 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1052820387 9:33133853-33133875 TCAATTTCCAGGAACATGCAAGG No data
1052820382_1052820389 13 Left 1052820382 9:33133835-33133857 CCTACCCCAGTGGGCATCTCAAT 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1052820389 9:33133871-33133893 CAAGGCTCCTTTCTGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052820382 Original CRISPR ATTGAGATGCCCACTGGGGT AGG (reversed) Intronic
901192335 1:7420092-7420114 GTGGAGGTCCCCACTGGGGTTGG - Intronic
901653117 1:10754486-10754508 CTTGAGGAGCCCACTGGGTTGGG - Intronic
901843773 1:11969668-11969690 ATTGAGGTGTCAGCTGGGGTTGG + Intronic
904917139 1:33978225-33978247 AATGAGATGCTCAATGTGGTGGG - Intronic
907890154 1:58629411-58629433 ATTTAGATGCCCAGTGTGTTAGG - Intergenic
908054999 1:60276182-60276204 ATTGAAATGCACACTGGACTTGG + Intergenic
909942580 1:81627405-81627427 ATTGAGCTGGACACTGAGGTAGG + Intronic
912797467 1:112701589-112701611 TTTGAGATGGCCACTCGGGCTGG - Exonic
920860026 1:209698409-209698431 CTTGAGATGCCCACCTGGCTGGG + Intronic
920929304 1:210371817-210371839 GTGAATATGCCCACTGGGGTTGG - Intronic
923124492 1:231023230-231023252 TTTCAGAAGCCCACTGGGCTTGG + Intronic
923271593 1:232359677-232359699 ATTGAGATGCACAGTGGTCTAGG - Intergenic
1066182510 10:32976990-32977012 ACTGAGCTTCCCAATGGGGTGGG + Intronic
1067568659 10:47355882-47355904 CTGGCAATGCCCACTGGGGTTGG - Intronic
1067771993 10:49133213-49133235 AGTGAGATGCCCCCTCGGGAAGG - Intronic
1069504790 10:68988294-68988316 TTTGGGATGCCCACTGGAGTGGG - Intergenic
1069796944 10:71059670-71059692 TTTGAGATGCCCACAGGAGCTGG - Intergenic
1070674718 10:78404578-78404600 AGTCAGATGTCCACTGGGGCTGG - Intergenic
1073867668 10:107823798-107823820 CTTGAGATACCCTCTGAGGTGGG - Intergenic
1077302853 11:1855164-1855186 ACTGAGAGCCCCAGTGGGGTAGG + Intronic
1078499363 11:11854568-11854590 ATTGTGATGGCCCCTGGGGGAGG - Intronic
1078595212 11:12680559-12680581 ATGGAGCTGCCCAGTGGGGGAGG - Intronic
1079755167 11:24249891-24249913 ATTTATATACCCACTGTGGTTGG - Intergenic
1081860791 11:46332514-46332536 ATTTAGAGACCCACTGGGTTTGG - Intergenic
1084714174 11:70863214-70863236 GTTGAGTGGCCCACTGGTGTGGG + Intronic
1085313832 11:75531503-75531525 ATGGAGGTGTCCCCTGGGGTGGG + Intergenic
1086952441 11:92904983-92905005 ATTGGCCTGTCCACTGGGGTAGG + Intergenic
1087563589 11:99822962-99822984 ATTGACAGGCCCACTGGGAGTGG + Intronic
1088587215 11:111369740-111369762 ATTGGGGTGGCCACTGGGGTAGG - Intronic
1089337692 11:117736316-117736338 ATTGAGATGCCCACATGGTGAGG - Intronic
1096529143 12:52232596-52232618 ATTCCGATGCCTACTGGAGTGGG + Intronic
1101503357 12:105325015-105325037 TTTGAGATTCCCACTGGCCTTGG + Intronic
1106583104 13:31034385-31034407 ATGGGGATGCACACTGGGGCCGG - Intergenic
1121061223 14:90912015-90912037 ATGGAGATGCGGACTGGGTTGGG - Intronic
1121448063 14:93990668-93990690 ATTGGGGTGCACATTGGGGTGGG + Intergenic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1122633395 14:103118500-103118522 ATTTGGAAGGCCACTGGGGTTGG + Intergenic
1131769928 15:95726429-95726451 ATTGAGCTGCTCACTGTTGTAGG - Intergenic
1134196002 16:12159561-12159583 ATAGAAATCCCCACTGGGGCTGG + Intronic
1134910942 16:18025734-18025756 ATGGAGATTCCGACTGGGGGTGG - Intergenic
1136254304 16:29028178-29028200 ATTGAGATGGTCTCTGGGGCAGG + Intergenic
1136730755 16:32409801-32409823 ATTGACATTCTAACTGGGGTGGG + Intergenic
1138588444 16:57986118-57986140 AATGTGCAGCCCACTGGGGTGGG + Intronic
1141792189 16:86244359-86244381 ATTGTGTTCCCCACTGGGGAAGG + Intergenic
1202995642 16_KI270728v1_random:107468-107490 ATTGACATTCTAACTGGGGTGGG - Intergenic
1203022329 16_KI270728v1_random:419810-419832 ATTGACATTCTAACTGGGGTGGG - Intergenic
1142933845 17:3310882-3310904 ATTGAGATGAACACTGGAGCAGG - Intergenic
1143431928 17:6894122-6894144 ACAGAGACGCCCGCTGGGGTGGG + Intronic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1149488849 17:57067360-57067382 CGTGACACGCCCACTGGGGTGGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152539681 17:80968677-80968699 AAGGAGATGCTCAGTGGGGTTGG + Intergenic
1157336251 18:46739674-46739696 ACTGAGAAGCCCTCTGGGGCAGG + Intronic
1160464459 18:79064697-79064719 ATCAAGATACCCACTGGGGGAGG + Intergenic
1161588924 19:5119891-5119913 TAGGAGATGCCCACGGGGGTGGG - Intronic
1161961557 19:7526322-7526344 CTGCAGATGTCCACTGGGGTGGG - Intronic
1161984978 19:7647990-7648012 CTTGAGATGCCCTCAGGGGCAGG - Intergenic
1162574872 19:11493467-11493489 AGTGAGATGCCCACTGTTGATGG + Intronic
1166072253 19:40394309-40394331 AGTGAGATGGTCACTGGGGAAGG - Exonic
926317275 2:11720004-11720026 AGCAAGCTGCCCACTGGGGTGGG - Intronic
926405287 2:12545554-12545576 TTTGAGATGCCTACTGGTGCTGG + Intergenic
926550167 2:14291828-14291850 ATTGAGATGGGCAGTGGGGGAGG + Intergenic
933576963 2:84080133-84080155 TTCGAGTTGCCCACTGGGTTGGG + Intergenic
934924436 2:98372086-98372108 GGTGAGATACCCACTGGAGTAGG + Intronic
935695717 2:105769080-105769102 AATGAGGTGACCAGTGGGGTTGG - Intronic
936671714 2:114664083-114664105 ATTGAGATTCTCATTGTGGTTGG + Intronic
939564584 2:143772037-143772059 ATTCAGATGCCTAGTGGGGCCGG + Intergenic
940001964 2:148975520-148975542 AATGAGATGAGCACTGGGGTGGG - Intronic
941662316 2:168207854-168207876 AATGAGATCCCAACTGAGGTCGG + Intronic
942455748 2:176137053-176137075 ACTGAGCTGCCCAAGGGGGTCGG - Intergenic
948555413 2:238806726-238806748 GGGGTGATGCCCACTGGGGTGGG + Intergenic
1169122665 20:3106796-3106818 ATTGTGATGGCCACTGGGGTGGG - Intergenic
1170493325 20:16900106-16900128 TTTGAGAGGCCCAATCGGGTGGG + Intergenic
1175986831 20:62768225-62768247 AGTCAGATGCGCCCTGGGGTGGG + Intergenic
1179769845 21:43606363-43606385 AATGTGATGCACACTGGGGCTGG + Intronic
1181019896 22:20094233-20094255 ACGGATATGCCCACTGGGGTCGG - Intronic
1182474172 22:30567207-30567229 ATGGTGATGACCTCTGGGGTTGG - Intronic
1183033226 22:35121121-35121143 ATTCTGGTTCCCACTGGGGTAGG + Intergenic
949940377 3:9150071-9150093 AGTGAGATGAACACTGGGATAGG + Intronic
951765048 3:26188370-26188392 ATTGAGATGCCCACCAGTGAAGG + Intergenic
952392819 3:32895019-32895041 GTGGAGATGCCCATTGGGTTTGG + Exonic
953803807 3:46050815-46050837 CTTGAAATGGCCACTGGGGAAGG + Intergenic
954527541 3:51285402-51285424 ATAAAGATGCTCACTGAGGTCGG + Intronic
956063131 3:65368964-65368986 ATGGAGATGCCCCATGGAGTGGG - Intronic
956278430 3:67529001-67529023 ATTGAAAGGCACACTGAGGTTGG - Intronic
956652234 3:71514761-71514783 ATTGAGCTGCTCACCTGGGTCGG - Intronic
960789166 3:121408355-121408377 ATTGAGATGAGCACTGTGCTAGG + Intronic
963493698 3:146033555-146033577 ATTGAGATGAAAACTGGGGGAGG + Intergenic
967609879 3:191491624-191491646 TTTGATTTGCCCACTGGAGTTGG + Intergenic
969251570 4:5971834-5971856 ATTGAAATGTTCACTGGGGTTGG - Intronic
970852490 4:20617656-20617678 AATGAGGTGCCCAGTGGGGCTGG - Intronic
974131366 4:57760471-57760493 AAAGAGCTGCCCACTGGGCTAGG - Intergenic
976283567 4:83348826-83348848 ATTGAGATGTCTAATGGTGTTGG - Intergenic
978490451 4:109306120-109306142 ATTGATATGCCCACTGGGAAAGG + Intergenic
980114791 4:128669078-128669100 TTCAAGATGCCCTCTGGGGTTGG + Intergenic
981798743 4:148631023-148631045 ATTGAGATGCCCAAAGGAGAAGG + Intergenic
983564053 4:169131145-169131167 TTTCAGTTTCCCACTGGGGTAGG + Intronic
990310766 5:54535843-54535865 CTGGAGATGCCCTCTGGGGAAGG - Intronic
993913376 5:93711238-93711260 ATTGAGATGTGAAATGGGGTGGG - Intronic
997523581 5:134538640-134538662 ACTGAGAAGCGCACTGGGGGTGG + Intronic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998059696 5:139110255-139110277 ATTTAGAGGGCTACTGGGGTGGG + Intronic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
999301667 5:150494625-150494647 ATTGAGATGCTGACTGGGTGCGG - Intronic
999720301 5:154394536-154394558 AATGAGATGAGCACTGGGCTTGG - Intronic
1000484279 5:161820619-161820641 AATGGGATGCCCACAGGGTTTGG - Intergenic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1004194511 6:13491125-13491147 ATGGAGATGCACAGTGGAGTAGG + Intergenic
1004681104 6:17895546-17895568 ATTGAGATGCAGCCAGGGGTAGG - Intronic
1005979677 6:30827363-30827385 ATTAAATTGCCCACTGAGGTGGG - Intergenic
1011613805 6:89179790-89179812 ATTGAGCTGCACACTGGAGGAGG + Intronic
1013327644 6:109063407-109063429 ATTGAGTTGCCTACTGGGTATGG - Intronic
1015307181 6:131722807-131722829 TTTGACATACCCACTAGGGTAGG + Intronic
1018239306 6:161756676-161756698 AGTGAAATACCCACTGGGTTAGG + Intronic
1020530557 7:9328736-9328758 ACAGAAAAGCCCACTGGGGTGGG - Intergenic
1022269632 7:28793592-28793614 ATTGAGATGCCCTCTGGGAATGG + Intronic
1023185780 7:37531456-37531478 ATTGAGTTGCCCACTGCTGTGGG + Intergenic
1023245521 7:38199249-38199271 ACTGAGATCCTCTCTGGGGTTGG - Intronic
1025801829 7:64794188-64794210 ATGCAAATGCCCTCTGGGGTGGG + Intergenic
1028271269 7:88792999-88793021 ATTGAGGTGCACACTGAGATTGG + Intronic
1031073985 7:117194796-117194818 CTTGAGATTTACACTGGGGTGGG + Intronic
1034511926 7:151542665-151542687 ACTGTGATGCCCAGTGAGGTTGG + Intergenic
1034907026 7:154958260-154958282 ATGGAGATGCTGACTGTGGTAGG - Intronic
1034924539 7:155110629-155110651 ATTGAGATGCCTAAAGGGGGAGG - Intergenic
1035762794 8:2081628-2081650 ATTGAGAAGAGCACTGGGGAAGG + Intronic
1038188871 8:25300526-25300548 AATGAGAGGCTAACTGGGGTTGG - Intronic
1038715595 8:29987993-29988015 AGTGAGAGCCCCACTGGGGCAGG + Intergenic
1040937449 8:52796201-52796223 ATGGGGATGGCCACTGGGGTGGG - Intergenic
1044337505 8:91004605-91004627 ATTCAGTGGCCCACTGGGGATGG + Intronic
1052228511 9:26119052-26119074 ATTCTGATGCTCAATGGGGTTGG + Intergenic
1052820382 9:33133835-33133857 ATTGAGATGCCCACTGGGGTAGG - Intronic
1059561352 9:115337966-115337988 TTTGAGATGCCAAGTGGGGGAGG - Intronic
1060813347 9:126622398-126622420 ACAGCGATGCCCACTGGGGCTGG + Intronic
1062097140 9:134709347-134709369 AGGGAGATGCCCACGGGGCTTGG - Intronic
1186499754 X:10041802-10041824 AGACAAATGCCCACTGGGGTTGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1189706326 X:43762393-43762415 ATTGAGCTGGTCACTGGTGTGGG - Intergenic
1194384072 X:93231572-93231594 ATTGAGAAGGCCAGAGGGGTTGG + Intergenic
1198066289 X:133099664-133099686 ACTGAGATTCCTTCTGGGGTGGG - Intergenic
1201553181 Y:15240162-15240184 ATTGAGATGCTAAATGGGTTTGG + Intergenic