ID: 1052828669

View in Genome Browser
Species Human (GRCh38)
Location 9:33197040-33197062
Sequence TGGAGAAGCTGCCTTCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052828669_1052828672 -9 Left 1052828669 9:33197040-33197062 CCTCTATGAAGGCAGCTTCTCCA No data
Right 1052828672 9:33197054-33197076 GCTTCTCCAAGCAGGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052828669 Original CRISPR TGGAGAAGCTGCCTTCATAG AGG (reversed) Intergenic
No off target data available for this crispr