ID: 1052831156

View in Genome Browser
Species Human (GRCh38)
Location 9:33216933-33216955
Sequence TAGTCCCTTCTCTGGGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052831150_1052831156 -7 Left 1052831150 9:33216917-33216939 CCAGCTGGCCCAGTCATAGTCCC No data
Right 1052831156 9:33216933-33216955 TAGTCCCTTCTCTGGGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052831156 Original CRISPR TAGTCCCTTCTCTGGGGATA TGG Intergenic
No off target data available for this crispr