ID: 1052833966

View in Genome Browser
Species Human (GRCh38)
Location 9:33236550-33236572
Sequence AGAAGCCATGTGGGCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052833966_1052833970 15 Left 1052833966 9:33236550-33236572 CCCACTTTGCCCACATGGCTTCT 0: 1
1: 0
2: 1
3: 27
4: 218
Right 1052833970 9:33236588-33236610 GAGAAGCTTCTTCTTGCCTCAGG No data
1052833966_1052833971 16 Left 1052833966 9:33236550-33236572 CCCACTTTGCCCACATGGCTTCT 0: 1
1: 0
2: 1
3: 27
4: 218
Right 1052833971 9:33236589-33236611 AGAAGCTTCTTCTTGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052833966 Original CRISPR AGAAGCCATGTGGGCAAAGT GGG (reversed) Intronic
901038666 1:6351222-6351244 AGAAGCCAGTTGGCCTAAGTGGG - Intronic
902984363 1:20146593-20146615 TGAAGACATGGGGGCAAAGAGGG - Intronic
905030205 1:34877226-34877248 AGAGACCCTGTGCGCAAAGTCGG + Intronic
905204008 1:36332555-36332577 AGGAGCCATCTGGGTATAGTTGG - Intergenic
905360428 1:37415628-37415650 ACAATCCATGTGTGCAAACTTGG + Intergenic
905470058 1:38185102-38185124 AGAAGGCATCTGGGGAAACTGGG + Intergenic
905745136 1:40409630-40409652 AGGAGCCATGTGGGGAAACCAGG + Intronic
905780963 1:40708854-40708876 AGAAGCAATGTGCACAAGGTCGG - Intronic
905849411 1:41262370-41262392 AGGGGCCATGTGGCCAAAGGAGG + Intergenic
907257315 1:53189713-53189735 AGAAGCAAGAAGGGCAAAGTGGG + Intergenic
908758433 1:67490356-67490378 AGAGGACATGTGGGCACAGTTGG - Intergenic
909599102 1:77442315-77442337 AGTAGCCATGTGGGCACAGAGGG + Intronic
911070151 1:93825871-93825893 AGCTGGCATGTGGGCAAATTAGG - Intronic
912953326 1:114135570-114135592 AGAAGCCAGGTGGGGGAAGTGGG + Intronic
914442810 1:147722105-147722127 AGAAGCCATGTGGGGAGAATTGG - Intergenic
914775762 1:150733406-150733428 AGAAGGCATATTTGCAAAGTAGG - Intronic
914850950 1:151313780-151313802 AGAAGCCATGTGGGGAAGAACGG - Intronic
915866776 1:159509550-159509572 GGAGGGCATGTGGGAAAAGTGGG - Intergenic
916444405 1:164858801-164858823 AGAAGGGAAGTAGGCAAAGTTGG + Intronic
916784178 1:168071943-168071965 TGAAGTCCTGGGGGCAAAGTTGG - Intronic
916821245 1:168400944-168400966 ATAAGCCATGTTGGCAATGATGG - Intergenic
916929308 1:169558592-169558614 AGAAGAGATGTGGTCTAAGTGGG + Intronic
917502177 1:175595515-175595537 CGAAGCCATGAGGGTAAAATCGG + Intronic
920159822 1:203988012-203988034 AGAAGCCATGTGGGTAGAAGTGG + Intergenic
920568860 1:207001164-207001186 AGGACCCATTTGAGCAAAGTGGG - Intergenic
922017321 1:221663744-221663766 AGATTCCATGTGGACAAATTTGG - Intergenic
923071786 1:230572393-230572415 GGAAGCCATGGGGGCAAGTTGGG - Intergenic
923539030 1:234875087-234875109 AGAAGCCATGTGGGGACATTCGG + Intergenic
924425569 1:243946935-243946957 AGAGGCCATGAGGGCAAAACTGG + Intergenic
1065518667 10:26551158-26551180 AGCAGCCAGGTGGACAAATTTGG - Intronic
1068482261 10:57606991-57607013 AGAAGCCATGTGTGAAAAACAGG - Intergenic
1069833116 10:71293248-71293270 AGAGGTCATGGGGGCAAAGGAGG - Intronic
1071544271 10:86516224-86516246 AGGAGAAATGTGGGCAAAGCAGG + Intronic
1072970662 10:100014516-100014538 ATAAGCCATGTGAACAAAGGAGG + Intergenic
1073069819 10:100786289-100786311 AGATGACATGTGGCCCAAGTGGG - Intronic
1073438338 10:103535926-103535948 AGTAGCCATGTGGGCACAGGGGG + Intronic
1074114853 10:110448137-110448159 AGAGGCCATGTGGGCAGATCTGG + Intergenic
1074968151 10:118511601-118511623 GGAAGGCATGTGTGCAAATTGGG + Intergenic
1075680267 10:124326266-124326288 GGAAGCCATGTGTGCACAGCAGG - Intergenic
1075930435 10:126290345-126290367 AGAAGCCCAGTGGGCATGGTTGG - Intronic
1077001617 11:326231-326253 AGAAGCACTGTGGGCTAAGGAGG + Intronic
1077550354 11:3197421-3197443 AGGAGGCAAGTGGGCAAGGTGGG + Intergenic
1079073935 11:17371739-17371761 AGGAGCCTTATGGGCCAAGTAGG + Intronic
1080368962 11:31611849-31611871 AGAAGCTAAGTGGGCAGAGAGGG + Intronic
1081305494 11:41506979-41507001 AAAAGCAAAGTTGGCAAAGTGGG - Intergenic
1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG + Intergenic
1081984669 11:47292918-47292940 AGAAGGCCTGTGGGCACAGTTGG + Intronic
1082999813 11:59280968-59280990 AGAAGCATTGTGTGCAAGGTAGG - Intergenic
1084032240 11:66487806-66487828 AGAAGGCATGGAGGCAAAGCAGG - Intronic
1087809708 11:102597075-102597097 TGAGGCCATGTGGGGAAAGTGGG + Intronic
1088598758 11:111457813-111457835 AGAAACCAAGGGGGCAAGGTGGG - Intronic
1089857136 11:121555939-121555961 AGACGGCATGTGGGTGAAGTGGG + Intronic
1090378938 11:126311589-126311611 AGAAGCCAGCTGTGCAAAGAGGG + Intronic
1090872590 11:130761613-130761635 AGTAGCAATGTGGGCAAATTCGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094629531 12:32159298-32159320 AGAAGCCATGTGGAGAGAGTAGG + Intronic
1095383028 12:41617104-41617126 AGAAGCCCTTTGGGCCAAATAGG - Intergenic
1099106519 12:78503550-78503572 AGAAGCCACATGGGTAAAGAAGG - Intergenic
1100486633 12:95035093-95035115 AGAAGCCATGAGGACAAATGGGG + Intronic
1102820455 12:115904653-115904675 AACAGCCATGTGTGCAAGGTTGG - Intergenic
1105915705 13:24914110-24914132 AAAAGCCACGTGGGAAAAGGAGG + Intronic
1106537288 13:30658332-30658354 AGAAGCCATTTGTGGGAAGTTGG + Exonic
1109048929 13:57452433-57452455 TGAAGCCATGTGAGGAAAGGAGG + Intergenic
1112737165 13:102433443-102433465 AGAAGCCAGAAGGGAAAAGTTGG + Intergenic
1112823527 13:103364504-103364526 AGAATACATGAGGGTAAAGTTGG - Intergenic
1113969589 13:114178611-114178633 TGAAGCCACGTGCGCAATGTTGG - Intergenic
1118021798 14:61724411-61724433 AGATGCCATGAGAGCAAAGGAGG - Intronic
1118347314 14:64949836-64949858 AGAAGCCATGGGGGCAGAAAGGG - Intronic
1120054966 14:79913508-79913530 AGAAGGGCTGAGGGCAAAGTGGG - Intergenic
1120080414 14:80210225-80210247 AGAAGTCATATGGGCATAGCAGG + Intronic
1120333255 14:83120717-83120739 AGAAGGCATGTTGGGAAAATGGG - Intergenic
1120584730 14:86298165-86298187 AGGAACAATGTGTGCAAAGTCGG - Intergenic
1121510380 14:94508605-94508627 AGAAACCATGTAGGAAAAGATGG + Intronic
1124786456 15:32685736-32685758 TGAAGCCATGGGAGAAAAGTGGG + Intronic
1125854171 15:42933256-42933278 AGAAGCCAAGAGGGCAAGATTGG + Intergenic
1126416359 15:48421692-48421714 AGAAGCAGTGGGGGCAAAGAGGG + Intronic
1127077252 15:55338806-55338828 AGCAACCATGTGAGCAAATTTGG + Intronic
1129953471 15:79612243-79612265 TGAAGCAATGTGGGCAGAGAAGG - Intergenic
1131098415 15:89670236-89670258 AGAAGCAATCTGGGGGAAGTTGG + Exonic
1131995570 15:98129641-98129663 AAAAACGATGTGGGAAAAGTAGG + Intergenic
1134562939 16:15226489-15226511 AGAAGCAATGGTGACAAAGTAGG - Intergenic
1134761336 16:16717713-16717735 TGAAGCCAAGAGGGAAAAGTTGG - Intergenic
1134923476 16:18138122-18138144 AGAAGCAATGGTGACAAAGTAGG - Intergenic
1134984723 16:18641457-18641479 TGAAGCCAAGAGGGAAAAGTTGG + Intergenic
1135300016 16:21318563-21318585 AAATGCCACCTGGGCAAAGTTGG + Intergenic
1135677945 16:24433110-24433132 AGAAGCCACGAGAGAAAAGTGGG + Intergenic
1137499284 16:48997938-48997960 AGGAGGCATGTGGGCTAAGGAGG - Intergenic
1141721645 16:85759290-85759312 AGGAGGTATGAGGGCAAAGTTGG + Intergenic
1142330839 16:89452341-89452363 ACAAGCCAAGAGGGCAAGGTAGG + Intronic
1143126193 17:4642205-4642227 AGAAGGCAAGTGTGCAAAGCTGG - Exonic
1143402432 17:6655193-6655215 GGAAGACAAGTGTGCAAAGTTGG + Intergenic
1146676545 17:34777230-34777252 AGAAACCAGGTGGGAAAAGGAGG - Intergenic
1146928583 17:36762132-36762154 CCAAGCCATGGGGGGAAAGTTGG - Intergenic
1147898582 17:43768956-43768978 AGAGGCCTTGTGGGCAAACCTGG - Exonic
1148336755 17:46847237-46847259 TGAAGCTAAGTGGGGAAAGTGGG - Intronic
1148437832 17:47696231-47696253 AGCAGTGATGAGGGCAAAGTGGG - Exonic
1149709264 17:58724862-58724884 AAATGGCATGTGGGCAAAGATGG + Intronic
1151500449 17:74484861-74484883 AGAAGCCTTGTGGGTGCAGTGGG + Intergenic
1152456267 17:80418170-80418192 AGAGGCCTAGAGGGCAAAGTGGG - Intronic
1154300108 18:13185018-13185040 AGGAGCCATGTGGCCCAAGGAGG + Intergenic
1154357260 18:13631377-13631399 TGAAGCCATGTGGTCCAGGTTGG - Intronic
1157301527 18:46483168-46483190 ACCATCCATGTGGGCAGAGTAGG - Intronic
1158702730 18:59763365-59763387 AGAATCCATGTTGGCAATGGTGG + Intergenic
1159899586 18:74033240-74033262 ACAAACCATGTGGGAAAAGCTGG + Intergenic
1161635039 19:5382934-5382956 AGAGGACAGGTGGGGAAAGTGGG - Intergenic
1165800955 19:38549637-38549659 AGAAAACATTTGGGCAATGTGGG - Intronic
925613011 2:5718938-5718960 AGATGTCATGTGGGCAGAGCAGG + Intergenic
927768716 2:25838538-25838560 AGTAGCCATGTGAGCATATTTGG + Intronic
928774675 2:34746027-34746049 AGAGGCTATGTGGAGAAAGTAGG - Intergenic
929759176 2:44791882-44791904 AGAAGAAATGTGGGAAAAGCAGG + Intergenic
929771564 2:44896649-44896671 AAAAGCCATGCGGTCAAACTTGG + Intergenic
930296249 2:49558094-49558116 AGAGGCTATGTGGCAAAAGTGGG + Intergenic
931195873 2:60052022-60052044 AGTAGGCATGATGGCAAAGTTGG + Intergenic
931634311 2:64328061-64328083 AGGAGCCGTGTGGGCAGAGAAGG - Intergenic
933294432 2:80472970-80472992 AGCAGACAAGTGGGCACAGTAGG - Intronic
938159919 2:128976015-128976037 GGAAGCCAGGAAGGCAAAGTTGG - Intergenic
938171259 2:129078898-129078920 AGAATTCACGTGGGAAAAGTAGG + Intergenic
938920168 2:135987603-135987625 ATAAGCCATGTAGGCAAGGGCGG + Intergenic
939831333 2:147075252-147075274 AGAAGCCCAGTGGGAAGAGTGGG + Intergenic
942521806 2:176812021-176812043 AGAAGCCATGTGTGCACACTAGG - Intergenic
946637461 2:221745401-221745423 AGAAGCTCTCTGGGCAATGTTGG - Intergenic
1170008418 20:11694095-11694117 AACAGCCATGTGAGCAAAGTGGG - Intergenic
1170111437 20:12808346-12808368 AGAAGCCAACTGGCCAAAATTGG + Intergenic
1171360045 20:24581085-24581107 AGAAGCAATGGAGGCAAAGTGGG + Intronic
1171363035 20:24603612-24603634 AGAAGCCCTGAGTGCAAAGCAGG + Intronic
1171971808 20:31569456-31569478 GGGAGCCAGGTGGGAAAAGTGGG + Exonic
1172316692 20:33960961-33960983 AAAAGCCATGGGAGCAACGTTGG - Intergenic
1172565416 20:35926675-35926697 AGAATCAATGTGGGCAGAGCGGG - Intronic
1174360094 20:50023478-50023500 GGAAGCTATGTGGCCAAAGTAGG - Intergenic
1174484070 20:50850659-50850681 AGAAGCCACAAGGGCAAAGTTGG - Intronic
1175821769 20:61913821-61913843 AGCAGCCAGGTGGGCACAGCCGG + Intronic
1176953130 21:15068429-15068451 ATTAGCCATGTAGGCAAAGTGGG + Intergenic
1178855897 21:36250183-36250205 AGAAGCCATGGTGGAAAAGAGGG + Intronic
1181313433 22:21957628-21957650 AGAGGGCAGGTGGGCACAGTGGG - Intronic
1181346539 22:22223700-22223722 AGAGGGCAGGTGGGCACAGTGGG - Intergenic
1181594984 22:23908294-23908316 ATGACCCATGTGGCCAAAGTGGG - Intergenic
1182518641 22:30872888-30872910 AGGAGCCATGTAGGCAAAGCCGG + Intronic
1183493698 22:38129881-38129903 AGGAGCCATGGGGACACAGTAGG + Intronic
950790610 3:15468718-15468740 AGAAGTCATGTGGGGAAAGTTGG + Intronic
952266704 3:31794128-31794150 AAAAACTATGTGGGGAAAGTGGG - Intronic
952333222 3:32383764-32383786 AGAAGTCATGTGTGGAAACTCGG - Intergenic
952878713 3:37969648-37969670 AGGAGTCTTGTGGGCAAAGTGGG + Intronic
954626270 3:52023671-52023693 AGGAGAAATGTGGGCAAAATGGG - Intergenic
955034245 3:55250779-55250801 AAAAGTAATCTGGGCAAAGTTGG + Intergenic
956140373 3:66140454-66140476 GGAAGCCAGGTAGGCAAAATGGG + Intronic
956284795 3:67597246-67597268 AGCAGCCCTGTGGGCAATGGTGG - Intronic
956657566 3:71567073-71567095 CCAAACAATGTGGGCAAAGTGGG + Intronic
960481811 3:118200673-118200695 AGAATCCATTTGGGTAAAGGGGG + Intergenic
961579656 3:127869961-127869983 AGAAGCCATGTTCTCAAAGATGG + Intergenic
962389797 3:134961661-134961683 AGAAGAGATGTGGGGAAACTAGG - Intronic
965388024 3:168069569-168069591 AGAAGCCATATGGGTAGAGAAGG + Intronic
967111409 3:186297383-186297405 ATAAGACTTGTGGGAAAAGTAGG - Intronic
967486428 3:190036913-190036935 AGAAACTATGTTGGCAACGTTGG + Intronic
968172336 3:196520506-196520528 AAGAGCGAAGTGGGCAAAGTGGG - Intergenic
969501808 4:7558093-7558115 AGCAGCCCTGGGGGCACAGTGGG - Intronic
969726222 4:8920064-8920086 AGAAGCCATGGAGGAGAAGTGGG + Intergenic
972276453 4:37562635-37562657 AAAAGGCTTGTGGGCAAAGGTGG - Intronic
974796512 4:66758314-66758336 AGTAGTCTTGTGGGCAAACTTGG - Intergenic
975538693 4:75480405-75480427 AAAAGCAATGTGGTAAAAGTGGG + Exonic
975721530 4:77253193-77253215 GGAGGCCAGGTGGGCAATGTGGG + Intronic
976082994 4:81376629-81376651 AGGAGACATGTGAGCCAAGTCGG - Intergenic
982755191 4:159209502-159209524 AGAAGACATTTGAGCAAAGGAGG - Intronic
983683444 4:170379633-170379655 GGAGGCCAAGTGGCCAAAGTGGG + Intergenic
985389067 4:189476084-189476106 AGAAGGCATGTGGTGAGAGTGGG + Intergenic
985669472 5:1200230-1200252 AGGAGCCATGTGGGCAGTGGGGG + Intergenic
988855060 5:35220255-35220277 AGAAGCAATGAGGGAAAGGTGGG - Intronic
991014581 5:61917207-61917229 AGAAGCCATCTGGAGAAAGGAGG + Intergenic
993072078 5:83177810-83177832 AGAAGCCTTGTGGGCCAGGAAGG + Intronic
996172727 5:120314342-120314364 AGAAGCACTATGGGCACAGTGGG + Intergenic
996943488 5:129038232-129038254 AGAAACCATGAGGGAAGAGTGGG + Intergenic
997767524 5:136519773-136519795 TGAAGCCATGTTGCCAAACTCGG - Intergenic
999354063 5:150907085-150907107 AGCAGCCATGTGAGCAAGCTTGG - Intergenic
1000023197 5:157336768-157336790 AAAAGCCATGTGGGCAGTTTAGG - Intronic
1002058658 5:176613093-176613115 ACAATGAATGTGGGCAAAGTGGG + Intergenic
1003882256 6:10489496-10489518 AGAGGCCATGAGAGCAAATTTGG - Intergenic
1004238386 6:13896104-13896126 AGATGGCAAGTGAGCAAAGTAGG + Intergenic
1005421398 6:25655040-25655062 AGAAGCCCTGTGGGCAAGGCTGG - Intronic
1006147766 6:31969499-31969521 AGAAGGGCTGTGGGGAAAGTAGG - Exonic
1011422650 6:87190035-87190057 AGAGTTCCTGTGGGCAAAGTTGG - Intronic
1011465100 6:87647248-87647270 AGAGGCCATGTGGGGAGAGGAGG - Intronic
1012015835 6:93850016-93850038 AGAGGCCATGTGAGCACAGAGGG + Intergenic
1013467316 6:110429238-110429260 AGAAACCATGTGGGCTGTGTGGG - Intronic
1014339234 6:120182016-120182038 AGAACTCATGGGTGCAAAGTGGG + Intergenic
1015547275 6:134374414-134374436 AGCAGCAATGTTGGAAAAGTTGG - Intergenic
1015589140 6:134805638-134805660 AGAAGCAACGAGAGCAAAGTAGG - Intergenic
1016577248 6:145583654-145583676 AGCAGCCATGGTGGCAAAGTGGG + Intronic
1016639593 6:146333727-146333749 AGAATCCAAGTGGGCACTGTTGG + Intronic
1016878036 6:148882981-148883003 AGAAGAGATGTGGGCAATGTGGG - Intronic
1017362804 6:153595716-153595738 AACAGCCATGTGGGTAAAATTGG - Intergenic
1017550262 6:155498477-155498499 AGAAGCAATATGGGCAGACTAGG - Intergenic
1017750329 6:157485549-157485571 AAAATCAATGTGGGAAAAGTGGG - Intronic
1018101614 6:160445691-160445713 AGAAGCCAGCTGGGCAAGATGGG + Intronic
1022595059 7:31705567-31705589 AGAACCCATGTGAACAAACTAGG + Intronic
1022981313 7:35607304-35607326 AAAATCCATGTGGCAAAAGTAGG + Intergenic
1023164242 7:37327439-37327461 ATAAGCCCTGAAGGCAAAGTAGG + Intronic
1024551003 7:50562309-50562331 AGCAGCCATGTGGACAATGGAGG + Intronic
1024682377 7:51706145-51706167 AGAAGCAATGAGGGAAAAGGGGG - Intergenic
1028515456 7:91673277-91673299 AGAAGCAGTGGGGGTAAAGTTGG - Intergenic
1030205406 7:106947757-106947779 AGAAGCTATTTGGTCTAAGTTGG - Intergenic
1032855187 7:135828190-135828212 AGAACCCTGGTGGGCACAGTTGG - Intergenic
1034214495 7:149394685-149394707 AGAGGCCATGTGGGAAGAGTGGG - Intergenic
1034697161 7:153064002-153064024 GGAGGCAATGTGGGCAAGGTGGG - Intergenic
1035456396 7:159011727-159011749 AGGAGCTGTGTGGGCAAAGGTGG - Intergenic
1037128987 8:15384934-15384956 AGAAACCATGGAGGCAGAGTGGG - Intergenic
1039588409 8:38726823-38726845 AGAAGCCATGTTGGCCAGGTTGG - Intergenic
1040014266 8:42688562-42688584 AAAAGACATCTGGGCAAGGTAGG + Intergenic
1042091807 8:65166629-65166651 AGAAGCCACGTGTGCCAGGTAGG - Intergenic
1043377955 8:79671116-79671138 AGAAGGCATGAAGGCAAAGGGGG + Intergenic
1043508371 8:80924933-80924955 AGAAGCCATGTGGGCTGTATTGG + Intergenic
1046587249 8:116162643-116162665 AGAAGCCAATGGGGCAAGGTTGG - Intergenic
1046753077 8:117945420-117945442 TGATGCCATTTGGGCAAAGGGGG + Intronic
1046872095 8:119215076-119215098 ATAGGTCATGTGGGCAAATTTGG + Intronic
1049022422 8:139966505-139966527 AGAAGCAATGCGTGCACAGTAGG - Intronic
1050015797 9:1232565-1232587 AGAAGCCATGTGTAAACAGTTGG + Intergenic
1051794458 9:20849234-20849256 AGAAGAAATGTTAGCAAAGTAGG - Intronic
1052232036 9:26165278-26165300 AGAAGCAAAGGGTGCAAAGTAGG + Intergenic
1052833966 9:33236550-33236572 AGAAGCCATGTGGGCAAAGTGGG - Intronic
1053383519 9:37668353-37668375 CCAGGCCATGTGGGCAAAGTTGG - Exonic
1054972299 9:71102477-71102499 AGTAGGCATGAGGGAAAAGTAGG - Intronic
1055453043 9:76447973-76447995 GGAAGCCATCTGGACAAAGACGG - Intronic
1056159995 9:83879632-83879654 AAAAGCCCTGTGGGACAAGTAGG + Intronic
1056278599 9:85017797-85017819 AGAACCCCAGTGGTCAAAGTGGG - Intronic
1056360231 9:85850186-85850208 AAAAGCCCTGTGGGACAAGTAGG - Intergenic
1056696123 9:88855129-88855151 AGAATGGATGTTGGCAAAGTTGG + Intergenic
1058522300 9:105823043-105823065 AGCAGCCAGGGGGGCAGAGTGGG - Intergenic
1060474043 9:123971712-123971734 AGGAGCTAGGTGGGCAAAGCAGG + Intergenic
1060961082 9:127681206-127681228 AGAAGACAGGTGGGGAAAGCAGG - Intronic
1061072894 9:128322687-128322709 AGAAGGCATGTAGGCCAAGTAGG - Exonic
1061178001 9:129009000-129009022 AGGGGCCCTGTTGGCAAAGTGGG - Intronic
1062152037 9:135024856-135024878 AGATGCCAGGTGGGCCAAGTTGG - Intergenic
1062329526 9:136031822-136031844 AAAAGCCATGTGGGTTAAATCGG - Intronic
1062725346 9:138070202-138070224 AGAGGCCACCTGGGCAAAGCGGG - Intronic
1186574772 X:10753014-10753036 AGAAGCCATTTGAGCAAACAGGG - Intronic
1187543191 X:20219647-20219669 AGAAGCCATGTTGGAAAAGAAGG + Intronic
1188387418 X:29578126-29578148 AAAAGCCATGTGAGAAAAATTGG + Intronic
1189059585 X:37738456-37738478 GGAACCCATGTGAGCAAACTCGG - Intronic
1189071913 X:37872972-37872994 ATGAGCCATGTGGACATAGTTGG - Intronic
1192188773 X:68978152-68978174 AGTAGCCTTGTGGGCAAGGCTGG - Intergenic
1194125544 X:90012086-90012108 AGAAAAAATGTGGGGAAAGTTGG + Intergenic
1194618436 X:96137048-96137070 AGAAGACATGAGGGAAAAGAAGG - Intergenic
1195725338 X:107909526-107909548 AGAATCCAAGTGGACGAAGTTGG - Intronic
1197926762 X:131655196-131655218 AGAAGCCATGGGGACAATATTGG - Intergenic
1198657979 X:138935376-138935398 AAATGCCCTGTGGGCAAAATAGG - Intronic
1199013275 X:142781747-142781769 AGAAGCATTGTGTGCAAAGAAGG - Intergenic
1200691655 Y:6311296-6311318 AGAATCCAGGTGGGCACAGATGG + Intergenic
1201043617 Y:9863428-9863450 AGAATCCAGGTGGGCACAGATGG - Intergenic
1202029628 Y:20558106-20558128 AGAAGCCTTTTGGGCTGAGTGGG - Intergenic