ID: 1052834881

View in Genome Browser
Species Human (GRCh38)
Location 9:33242850-33242872
Sequence CAGAGCACTGGGATGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 1, 1: 0, 2: 9, 3: 76, 4: 736}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052834881_1052834889 30 Left 1052834881 9:33242850-33242872 CCTGCCCCCATCCCAGTGCTCTG 0: 1
1: 0
2: 9
3: 76
4: 736
Right 1052834889 9:33242903-33242925 TCTCACTCTGTTGCCCAGGCTGG 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
1052834881_1052834888 26 Left 1052834881 9:33242850-33242872 CCTGCCCCCATCCCAGTGCTCTG 0: 1
1: 0
2: 9
3: 76
4: 736
Right 1052834888 9:33242899-33242921 AAAGTCTCACTCTGTTGCCCAGG 0: 404
1: 10850
2: 43046
3: 106798
4: 186102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052834881 Original CRISPR CAGAGCACTGGGATGGGGGC AGG (reversed) Intronic
900103018 1:970887-970909 CAGAGCACCAGGAGGGGTGCGGG - Exonic
900122920 1:1056790-1056812 CAGAGCACAGGGTTGGGAGGAGG + Intergenic
900155599 1:1202280-1202302 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155614 1:1202318-1202340 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155648 1:1202413-1202435 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155675 1:1202489-1202511 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900324965 1:2104215-2104237 CACCTCACTGGGATGTGGGCGGG + Intronic
900406097 1:2493653-2493675 CAGAGCACAGGGAGGCTGGCGGG + Intronic
901001120 1:6149212-6149234 CAGAGCCCCGGGCTGGGGGCGGG - Intronic
901529286 1:9843347-9843369 CAGGCCTCTGGGCTGGGGGCTGG + Intergenic
901541790 1:9922573-9922595 CTGAGCACTGTGCTAGGGGCAGG - Intronic
901635917 1:10670075-10670097 CAGACCCCTGGGTTGGGGGTGGG + Intronic
901786698 1:11629577-11629599 CTGCGCACTGGGCTGGGGGCTGG - Intergenic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902094265 1:13929701-13929723 CATAGGAAAGGGATGGGGGCTGG + Intergenic
902188716 1:14745160-14745182 CAGGGCACTGGGATGGTGCTGGG - Intronic
902227712 1:15007258-15007280 CAGAGCACTAGGTGAGGGGCTGG + Intronic
902250440 1:15151629-15151651 GAGAGGCCTGGGGTGGGGGCGGG - Intergenic
902503492 1:16925435-16925457 CAGAGCCCTGGGCTGGGAGTTGG - Intronic
902542775 1:17166386-17166408 CAGGGCCCTGGCTTGGGGGCTGG + Intergenic
903179151 1:21596841-21596863 GTGAGCACTGGGTTGGGAGCCGG - Intronic
903279541 1:22242640-22242662 CACAGAACTGGGGTGGGGACAGG + Intergenic
903318395 1:22526705-22526727 AAGAGCAGTGGGATGGGAGCTGG + Exonic
903334320 1:22614691-22614713 AAGAGCATGGGGATGGGGGCTGG - Intergenic
903355013 1:22741124-22741146 CAGAGAACAGGGGTCGGGGCAGG - Intronic
903543918 1:24111807-24111829 CAGAACAGTGGGATGGGGCAGGG + Intronic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
904212458 1:28894957-28894979 CAGGGCCCTGGGATAAGGGCTGG + Intronic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
904304380 1:29578162-29578184 CACAGCACCGGCATGGGGCCTGG - Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904604395 1:31690998-31691020 GTGAGCACTGGGATGGGGACAGG + Intronic
904616588 1:31753425-31753447 AAGAGCACTGGGCTGGGGGCTGG - Intronic
904811431 1:33165577-33165599 CACAGGGCCGGGATGGGGGCAGG + Intronic
904835801 1:33335283-33335305 AACAGCCCTGGGAAGGGGGCGGG - Intronic
904964699 1:34362418-34362440 TGGAGCAGTGGGATTGGGGCGGG + Intergenic
905146903 1:35893929-35893951 AAGGGCATTGGGATGGGGGAAGG - Intronic
905257858 1:36696619-36696641 CTGAGCAGTGGGATGGAGCCAGG - Intergenic
905294120 1:36943290-36943312 CAGGGACCTGGGATGGGGGAGGG - Intronic
905299943 1:36980307-36980329 CAGAGCACGGGAAGTGGGGCTGG - Intronic
905369990 1:37477735-37477757 AAGAGAACTGGAATGGGGGCAGG + Intronic
905371832 1:37486583-37486605 TAGAGAAGTGGGATGGGGACTGG - Intergenic
905487626 1:38315136-38315158 CATAGCTTTAGGATGGGGGCTGG + Intergenic
905565306 1:38959786-38959808 TAGAGCACTGGCATGTGGACTGG - Intergenic
905720898 1:40200675-40200697 CAGAGCACTGGGGTCAGGGTAGG + Intronic
906517163 1:46446485-46446507 AAGAGGAATGGGATGGGGGAAGG - Intergenic
907190044 1:52640834-52640856 GAGAGCCTTAGGATGGGGGCTGG + Intronic
907247148 1:53115587-53115609 GAGAGCGCTGGGCTGGGGGCTGG + Intronic
907314828 1:53561630-53561652 CAGAGCACTGGCCTGGGGTGGGG + Intronic
907440425 1:54475081-54475103 CAGAGCAAAGGGGTGGGGCCAGG + Intergenic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
907806717 1:57827780-57827802 GGCGGCACTGGGATGGGGGCAGG + Intronic
908303380 1:62784590-62784612 CAGAGCACTGGCATGAGGAGGGG - Intronic
909036968 1:70604404-70604426 CAGGGCACAGGGATGGTGGAGGG - Intergenic
909675682 1:78236879-78236901 CTGAGCTCTGGAATGTGGGCTGG + Intergenic
911086111 1:93978703-93978725 CAGAGCAGAGGGAGGGGTGCTGG - Intergenic
911168394 1:94745398-94745420 CAGAGCAGTGGGAATGGGGATGG + Intergenic
911325736 1:96469396-96469418 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
912511782 1:110194782-110194804 CAGAGCCTGGGCATGGGGGCAGG - Intronic
912756132 1:112326142-112326164 GAGACCACTGGGGTGGGGGTGGG - Intergenic
913170964 1:116231929-116231951 CACAGCATTGGGATGGTGGGGGG - Intergenic
913558699 1:119996702-119996724 CAGAGCTCTGGGAAAGGGACAGG - Intronic
913585469 1:120271184-120271206 CAGAAGACTGGGATCTGGGCAGG - Intergenic
913622714 1:120627183-120627205 CAGAAGACTGGGATCTGGGCAGG + Intergenic
914241723 1:145857334-145857356 CAGAGTCCAGGGATGGAGGCGGG - Intronic
914417620 1:147498433-147498455 CAGAGTACTGGGGTGGGACCAGG - Intergenic
914467926 1:147949059-147949081 GAGAGCACAGGGTTGGGGGTAGG + Intronic
914567474 1:148883043-148883065 CAGAAGACTGGGATCTGGGCAGG - Intronic
914605348 1:149247202-149247224 CAGAAGACTGGGATCTGGGCAGG + Intergenic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
915083281 1:153366623-153366645 CAGAGCACTGTTATAGGTGCTGG + Intergenic
915139643 1:153759303-153759325 CAGAGGACAGGGATTGGGCCAGG - Intronic
915292832 1:154897756-154897778 ATGAGCACAGGTATGGGGGCGGG + Intergenic
916074836 1:161194215-161194237 CAGTGCCCTGGGAAGGGGGTTGG + Exonic
916183190 1:162105778-162105800 CAAACCACAGGGATGGTGGCTGG + Intronic
916632482 1:166631297-166631319 CCGAGAAATGGGATGGGGCCCGG + Intergenic
917114788 1:171591864-171591886 CAGGGGATTGGGAGGGGGGCGGG + Exonic
917127519 1:171700778-171700800 CACAGCACTGTGCTGGGTGCTGG + Exonic
917713781 1:177712935-177712957 TAGTGAACTGGGATGGGGGCTGG - Intergenic
918767210 1:188501486-188501508 CATGGCACTGTGATGGGGGTAGG + Intergenic
919764335 1:201116421-201116443 CAGACCACAGGGACTGGGGCAGG - Intronic
919767734 1:201138171-201138193 CAGAGCAGTGGAAGGAGGGCAGG - Intronic
919805920 1:201380979-201381001 CAGAGCATGGGGGTGGGGGTTGG + Exonic
919887203 1:201943492-201943514 CACAGCACCGTGCTGGGGGCAGG - Intronic
919978457 1:202627975-202627997 AAGAGCCCTGGGCTGGGTGCTGG - Intronic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920311609 1:205052073-205052095 AAGAGCAGTGGGAGGGGGTCAGG - Intronic
920339741 1:205268316-205268338 AAGAGCTCTGGGCTGGGGCCAGG + Intronic
920578132 1:207078352-207078374 CGGAGGTCTGGGATGGGGCCTGG - Intronic
920915711 1:210256348-210256370 CAGAGCATTAGAATGGGGTCAGG + Intergenic
921267530 1:213435846-213435868 AAGAGTACAGGGGTGGGGGCTGG - Intergenic
921340515 1:214129444-214129466 CAGAGCACAGGACTGAGGGCTGG + Intergenic
921481458 1:215668733-215668755 TAGAAAACTGGGATGGGGCCTGG + Intronic
921826594 1:219678966-219678988 CAGGGCAGTGGGGTGGGGGATGG + Intergenic
922182514 1:223246467-223246489 AAGAGCTCTGGGGTGGGGGCGGG - Intronic
922563179 1:226583788-226583810 CAGGGCTCTGGGACGGGGGATGG + Intronic
922614004 1:226950283-226950305 GTGAGCACTGGGTTGGGAGCTGG - Intronic
922975532 1:229780478-229780500 CAGAGCACTGGGTGGCAGGCAGG + Intergenic
923148968 1:231217343-231217365 CAGGGCTCTGGGATGGGAGGAGG - Intronic
923689226 1:236176547-236176569 CACAGCCCTGTGCTGGGGGCTGG - Intronic
1064104316 10:12488513-12488535 CCGTGGACTGGGATGGGGGATGG + Intronic
1064250852 10:13705427-13705449 CAGAGCACAGGCATGGCGGAGGG + Intronic
1064531030 10:16309655-16309677 CAGAAAAGTGGGATGGGGGTTGG + Intergenic
1064745613 10:18475376-18475398 GAGAGCCTTGGGATGGGGCCTGG - Intronic
1064841555 10:19598048-19598070 TATAGCACTGGCATGGTGGCAGG - Intronic
1065102873 10:22348248-22348270 CAAAGCACTGGGATTGCGCCCGG + Intronic
1066586910 10:36945678-36945700 ATGAGCACTGGGATAGGGGAGGG - Intergenic
1067039000 10:42938760-42938782 CGGTGCTCTGGGCTGGGGGCAGG + Intergenic
1067227816 10:44386751-44386773 CAGAGCTCTGGGAGCGGGGAGGG - Intergenic
1067288779 10:44926731-44926753 CAGAGCACTTGGATCTAGGCAGG - Intronic
1067727994 10:48787445-48787467 CAGAGCAATGGGACGAGGTCAGG + Intronic
1067734179 10:48836690-48836712 CAGGGGACTGTGATGGGGTCAGG - Intronic
1068894702 10:62186545-62186567 CAGAGTGCTGGGGTGGGGGTGGG + Intronic
1069149200 10:64934352-64934374 AAGAGATCTGGGATGGGGCCTGG - Intergenic
1069566412 10:69466237-69466259 CAGAGCACTGGCCTGGGAGCTGG + Intronic
1069789361 10:71009902-71009924 CAGAGCACTGGACTGGGGCAGGG - Intergenic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1070864179 10:79696149-79696171 CACACCACTGGGGTGGGGGGCGG - Intergenic
1071108232 10:82123803-82123825 CAGAGCTCTGGGGTGGGACCAGG - Intronic
1071631077 10:87218375-87218397 CACACCACTGGGGTGGGGGGCGG - Intergenic
1072759637 10:98045846-98045868 CAGAGGACTAGGGTGAGGGCAGG - Intergenic
1073152866 10:101323614-101323636 CTTTGGACTGGGATGGGGGCAGG - Intergenic
1073470386 10:103718473-103718495 CAGGGCAAAGGGCTGGGGGCTGG + Intronic
1073564085 10:104520629-104520651 AAGAGCAGAGGGATTGGGGCTGG + Intergenic
1075136602 10:119791995-119792017 CAGAGCACTGGGGAGAGGGACGG + Exonic
1075438506 10:122461801-122461823 CGGAGCACTGCGAGGGCGGCCGG + Exonic
1075472579 10:122703994-122704016 CAGAGCCCAGGGATGGCTGCAGG - Intergenic
1075630390 10:123997157-123997179 CAGAGGCCAGGGCTGGGGGCTGG + Intergenic
1075841805 10:125511247-125511269 CTGAGCACCGCGACGGGGGCGGG - Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076475183 10:130746670-130746692 CAGAGCACCGGGGTTGGGGGCGG - Intergenic
1076494076 10:130885427-130885449 AACTGCACTGGGGTGGGGGCAGG + Intergenic
1076500460 10:130932442-130932464 CTGGGCACAGGGATGGGGTCTGG - Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076560474 10:131360097-131360119 CAGTCCAGTGGGTTGGGGGCAGG - Intergenic
1076733828 10:132450284-132450306 GTGAGGACTGGGGTGGGGGCTGG - Intergenic
1077182592 11:1223334-1223356 CAGAGCCCTGTGTTGGGGACGGG - Intronic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1078937489 11:15964620-15964642 CCAAGCACTGTGTTGGGGGCAGG + Intergenic
1079642995 11:22829893-22829915 CAGAGCTGCGGGGTGGGGGCGGG - Intronic
1080110975 11:28567520-28567542 CTGAGCACTGGGCTAGGCGCTGG + Intergenic
1080121216 11:28680190-28680212 CAGAGCTCTAGGATGGGGCCAGG - Intergenic
1080556036 11:33418371-33418393 CAGAGGCCTGGCATGGGGTCTGG + Intergenic
1080625587 11:34027933-34027955 GATAGCCTTGGGATGGGGGCTGG - Intergenic
1080675684 11:34424328-34424350 CAAAGCATTGGGATGGAGGTAGG + Intergenic
1081144265 11:39542240-39542262 GAGATCACTGGGAAGGGGGTGGG + Intergenic
1082083712 11:48032047-48032069 CAGAGCACTGGGCACTGGGCTGG - Intronic
1082777604 11:57259444-57259466 CAGGGCACTGGGATGAATGCAGG + Intergenic
1082985021 11:59161045-59161067 CAGAGCCCTGACCTGGGGGCTGG - Intergenic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083294936 11:61710189-61710211 CAGAGCGCTGGGATTCGTGCTGG + Intronic
1083547239 11:63558169-63558191 CAGTGCAGTGGGTTGGGGGGTGG - Intronic
1083672533 11:64307117-64307139 GAAAGCACTGGTATGGGGGATGG - Intronic
1084178886 11:67437010-67437032 CTGAGGCCTGGGATGGGGGATGG + Intronic
1084363178 11:68682538-68682560 AAGAGCTCTGGGATGGTAGCAGG + Intergenic
1084364549 11:68689103-68689125 CAGAGGGCTGGGATTGCGGCAGG + Intronic
1084369976 11:68734904-68734926 CAGAGCAGTGAGGTGAGGGCAGG - Intronic
1084435621 11:69137631-69137653 CAGAGGCCTGGGGTGGGGCCAGG + Intergenic
1084489635 11:69471383-69471405 GAGGGCATTGGGATGGGGCCGGG - Intergenic
1084537106 11:69763752-69763774 CCGAGCACAGGGATGTGGGGAGG + Intergenic
1084948026 11:72649473-72649495 CAGAGCACAGGAGTTGGGGCTGG + Intronic
1085351861 11:75802811-75802833 CAGAGCAGTGGGAGGAGTGCTGG + Intergenic
1085446490 11:76604319-76604341 GGGAGAACAGGGATGGGGGCGGG - Intergenic
1085508002 11:77071129-77071151 GTGGGCACTGGGGTGGGGGCGGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1087311728 11:96551516-96551538 CACACCACTGGGGTAGGGGCGGG + Intergenic
1088598441 11:111456468-111456490 CTCAGCCCTGGGCTGGGGGCCGG - Intronic
1088645155 11:111912012-111912034 CAGAGAACAGGGGTGGGGGTGGG - Intronic
1088739595 11:112756306-112756328 GACAGCACTGGGGTGGGGGTCGG + Intergenic
1089025793 11:115268568-115268590 CAGAGCACTGAGCTGGGGTAGGG - Intronic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089207977 11:116780358-116780380 GAGAGCTGTGGGAAGGGGGCTGG - Intronic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089345815 11:117791009-117791031 CAGGGCACAGGGAGTGGGGCAGG + Intronic
1089376455 11:117998650-117998672 GGCAGCACTGGGATGGGTGCTGG + Intronic
1089688594 11:120172262-120172284 CAGAGCACCGGGATGGGGAAAGG + Intronic
1090442655 11:126737192-126737214 CAGCACACTGGGCTGGGGCCTGG + Intronic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091392396 12:133568-133590 CAGAGCACAGGGCTCAGGGCAGG + Intronic
1091407885 12:220470-220492 CTCAGCACGGTGATGGGGGCGGG - Intergenic
1091444337 12:535017-535039 AAGAGGGCTGGGCTGGGGGCAGG - Intronic
1091588186 12:1827890-1827912 CAAGCCCCTGGGATGGGGGCGGG - Intronic
1092020794 12:5200726-5200748 CAGACCACGGGGTCGGGGGCGGG + Intergenic
1093588965 12:20876533-20876555 AAGAGCAATGGGATGGATGCTGG + Intronic
1094452976 12:30601646-30601668 CACTGCACAGGGATGGGGGATGG - Intergenic
1094492672 12:30970737-30970759 CTGAGCCCTGGGCTGGGGCCAGG + Intronic
1094703440 12:32892799-32892821 CAGATACCTGGGGTGGGGGCGGG + Intronic
1095330610 12:40957330-40957352 CAGAGCACTGGGAGAGGTGAAGG + Intronic
1095507980 12:42918495-42918517 CAGAGCTCTGGGTGGGGGGAAGG - Intergenic
1095990245 12:48029599-48029621 CAGGGGTCTGGGATGGGGGAGGG - Intergenic
1096429357 12:51530590-51530612 AGGAGCACTGGGACGGGGGTGGG + Intergenic
1096475672 12:51907493-51907515 CCCGGGACTGGGATGGGGGCTGG - Exonic
1096495217 12:52036104-52036126 TGGAGCAATGGGATTGGGGCTGG - Intronic
1096626337 12:52898428-52898450 CAGGGCCCTGGGATGAGGGCGGG - Intronic
1096649432 12:53054552-53054574 CAGAGTGGTGGGGTGGGGGCGGG + Intronic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1096807495 12:54149350-54149372 CACAGCTCTGGGAAGGGGGTGGG + Intergenic
1097194531 12:57236265-57236287 CAGAGCACTGGGGTTGTGGCCGG - Intronic
1097399108 12:59108340-59108362 GAGAGCACAGGGTTGGGGGTAGG - Intergenic
1097938111 12:65276072-65276094 CACACCACTGGGTTGGGGGAGGG + Intergenic
1098884087 12:75942808-75942830 GAGAGCACAGGGTTGGGGGTAGG - Intergenic
1099015411 12:77338209-77338231 CAAAGCATTGTGTTGGGGGCAGG - Intergenic
1101317726 12:103644227-103644249 GAGAGCACAGGGTTGGGGGTAGG - Intronic
1101357661 12:103995547-103995569 CAGAGGATTGGGGTGGAGGCAGG - Intronic
1101434683 12:104654638-104654660 TGGAGCACTGGGCTGGGGGCAGG - Intronic
1101613787 12:106316388-106316410 GACAGCACTGAGATGGGGTCAGG - Intronic
1101880554 12:108622980-108623002 CAGAGCTGTGGAATGGGGTCTGG + Exonic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1103364142 12:120369727-120369749 TAGAGCCCTGGGGTGGGGGTGGG - Intergenic
1103771819 12:123332827-123332849 CAAAGTACTGGGATTGGGCCGGG + Intronic
1104059120 12:125252888-125252910 CAGAGGTCTGGGATGAGGTCAGG - Intronic
1104689357 12:130813714-130813736 CAGAGCCCAGGGAGGGTGGCAGG + Intronic
1104957014 12:132471919-132471941 CAGGGTACGGGGATGGGGCCTGG + Intergenic
1106263666 13:28090962-28090984 GACAGTACTGGGATGGGGGTGGG + Intronic
1106364386 13:29064066-29064088 CAGAGCACTGGGATGTGTTGTGG + Intronic
1106834373 13:33617748-33617770 CCAAGCACTGGTATAGGGGCTGG + Intergenic
1110319781 13:74148346-74148368 CAGAGAAATGGGATGGGAGCTGG - Intergenic
1111438273 13:88240750-88240772 CAGAGAGCTGGAAAGGGGGCAGG + Intergenic
1111711500 13:91820476-91820498 CAGAGTAGTGGGATGGTGGTGGG - Intronic
1111791249 13:92858312-92858334 AAGAGCAAAGGGATGGTGGCAGG - Intronic
1114244520 14:20900246-20900268 CGTAGCATTAGGATGGGGGCTGG - Intergenic
1114309125 14:21450505-21450527 CTGAGCACTGTGATATGGGCCGG + Intronic
1115504402 14:34079483-34079505 GAGAGCACAGGGTTGGGGGTAGG - Intronic
1115753273 14:36510810-36510832 CAGAGCACAGGGACAGGGGAAGG + Intronic
1117004735 14:51409084-51409106 CATTTCACAGGGATGGGGGCAGG + Intergenic
1118615558 14:67572384-67572406 TAGAGCTGGGGGATGGGGGCAGG + Intronic
1118956566 14:70488500-70488522 CAGTGGACTGGGTTGGTGGCAGG + Intergenic
1119184658 14:72631441-72631463 GAGAACACTGGGATGGGTACAGG + Intronic
1119547031 14:75479433-75479455 CTGACCACTGGGATTGGGGTGGG - Intergenic
1119721923 14:76897750-76897772 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
1119728356 14:76935846-76935868 CAGGGCTGTGGGCTGGGGGCTGG - Intergenic
1120546351 14:85816693-85816715 CAAAGCACTGGTATGGGAGAAGG + Intergenic
1121096238 14:91219897-91219919 CAGAGCTCTGGGCAGGGGGTGGG + Intronic
1121257080 14:92538971-92538993 CAGACCCCTGGGAGGGGGCCTGG - Intronic
1121324858 14:93013938-93013960 AGAGGCACTGGGATGGGGGCTGG - Intronic
1121432925 14:93900177-93900199 CAGAGAACTGGCATATGGGCTGG + Intergenic
1121450566 14:94004555-94004577 CAGAGGACTGGGAAGGGGCATGG - Intergenic
1121602700 14:95217905-95217927 CAGAGAACTGGGATGAGGGAAGG + Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1122516904 14:102315241-102315263 CAGAGCACTGGTGGGGGTGCAGG - Intergenic
1122630110 14:103103910-103103932 CAGGGCAGGGGGCTGGGGGCGGG - Intronic
1122661949 14:103301958-103301980 CAGAGCTCTGGGTTTGGGCCTGG - Intergenic
1122941652 14:104984243-104984265 CAGGGAGCTGGGAGGGGGGCAGG - Intergenic
1122974171 14:105164266-105164288 CAAAGCTTTGGTATGGGGGCAGG - Intronic
1123054356 14:105562091-105562113 CAGGGCACGGGTCTGGGGGCTGG + Intergenic
1123078940 14:105682510-105682532 CAGGGCACGGGTCTGGGGGCTGG + Intergenic
1124189789 15:27564810-27564832 GAGAGCACTGAGAGGGGGGTGGG - Intergenic
1124630263 15:31332464-31332486 TGGAGCAGTAGGATGGGGGCTGG + Intronic
1125193516 15:37020521-37020543 CAAAGCACCTGGATGGAGGCAGG - Intronic
1125766961 15:42142473-42142495 CAGAGCCCTGGGATGGTGATGGG - Intronic
1125832604 15:42727568-42727590 CAGAGCAGGGGGGTGGGAGCAGG + Intronic
1125898775 15:43326181-43326203 CAGAACACTGTGATGAGGCCAGG - Exonic
1126766650 15:52017291-52017313 AAGAGCAATGGTTTGGGGGCAGG + Intronic
1127395718 15:58542505-58542527 GACAGCAGCGGGATGGGGGCAGG - Intronic
1127683880 15:61322994-61323016 CTGAGCACTGAGATTGGTGCTGG - Intergenic
1128225037 15:65995568-65995590 AAGAGCACTGGGCTAGGCGCAGG + Intronic
1128313657 15:66646893-66646915 CAGGGCCCTGGGGTGGGTGCAGG - Intronic
1128323209 15:66706616-66706638 CAGGGCTCTGGGAAGAGGGCCGG + Intronic
1128384183 15:67135326-67135348 CAGGGGACTGTGAAGGGGGCAGG - Intronic
1128559667 15:68656195-68656217 AAGAGCCTTGGGATGGGAGCGGG - Intronic
1128751319 15:70152184-70152206 CAGAGCACTGTGCTGGGGAAAGG - Intergenic
1129110039 15:73331921-73331943 CACAGCTCTGGGTTGGGAGCTGG - Intronic
1129207160 15:74044157-74044179 GAGAGCTCTGGGGTGGGAGCAGG - Intronic
1129506254 15:76083918-76083940 CAGAGTATTAGGATGGGGTCAGG + Intronic
1130253684 15:82316117-82316139 CAGAGGCCTGGGATTGGGGTTGG + Intergenic
1130960919 15:88658163-88658185 CCCAGCACTGGGCGGGGGGCCGG + Intergenic
1131116965 15:89801726-89801748 AAGGGCACTGGGCTGGGAGCCGG + Intronic
1131188046 15:90292309-90292331 CATAGCACTGGGAAGGGTGGAGG - Intronic
1131426040 15:92346280-92346302 GATAGCACCAGGATGGGGGCTGG + Intergenic
1131920630 15:97324176-97324198 CAGAGAAGTGGGATGGGAGGTGG + Intergenic
1132195686 15:99913149-99913171 CAGAGCACTGAGGTGCAGGCTGG + Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133027820 16:2996387-2996409 CAGGGCCCTGGGAGGGGGCCTGG - Intergenic
1133340244 16:5031264-5031286 CAGAATACTGGGATGGGGACAGG - Intronic
1133781132 16:8940369-8940391 CTGAGCACTGTGCTGGAGGCTGG - Intronic
1134610823 16:15606645-15606667 CAGGGCAATAGGCTGGGGGCAGG - Intronic
1135656656 16:24256130-24256152 CAGAGTCCTGGGGCGGGGGCCGG - Exonic
1135996332 16:27252195-27252217 CAGGCCCCTAGGATGGGGGCTGG + Intronic
1136558790 16:31025985-31026007 CAGAGACCTGAGACGGGGGCCGG + Intergenic
1136580767 16:31149625-31149647 CAGAGGACTGGCATGGGTGCTGG - Intronic
1136985780 16:35103024-35103046 CAGAGCAGTGGGGAAGGGGCAGG - Intergenic
1137018418 16:35398260-35398282 CAGACCAGTGGCATGGGGGAGGG - Intergenic
1137516476 16:49148891-49148913 AAGAGAACTTGGTTGGGGGCAGG - Intergenic
1138094912 16:54204005-54204027 CAGAAAAATGGGATGGGTGCCGG + Intergenic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138961381 16:62034515-62034537 CAGATCCGAGGGATGGGGGCTGG - Intronic
1139527417 16:67525457-67525479 CAGAAAGCTGGGATGGGGGTGGG + Intronic
1139576657 16:67846602-67846624 CTGTGCACTGGGGTGGGGGTTGG - Intronic
1140733894 16:77880748-77880770 AAGGGGACTGGGAGGGGGGCAGG - Intronic
1140899189 16:79352386-79352408 CATAGCACTGAGGTGGGGTCAGG + Intergenic
1142097056 16:88245889-88245911 CAGACCACAGGGACTGGGGCTGG + Intergenic
1142108295 16:88317999-88318021 CAGAGGACAGGGCTGGGGCCAGG - Intergenic
1142131016 16:88431483-88431505 CAGAACACTGGGTTTGGGGCAGG - Exonic
1142160622 16:88555610-88555632 TAACACACTGGGATGGGGGCCGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142341435 16:89525520-89525542 CAGAGGACAGGGATGAGGGGTGG - Intronic
1142939499 17:3370925-3370947 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
1143092634 17:4458008-4458030 CAGAGCCAAGGGGTGGGGGCGGG - Intronic
1143258425 17:5581551-5581573 CAGGGCACTGGCCTGGGGTCAGG - Intronic
1143519713 17:7438344-7438366 CAGAGCACTGGGCCGGTGGCTGG - Intronic
1143926601 17:10376710-10376732 CACAGGACTGGGGTGGGGTCGGG + Intergenic
1144624861 17:16839472-16839494 CAGAGGCCAGGGATGGGGGTGGG - Intergenic
1144645708 17:16972178-16972200 CAATGCACAGGCATGGGGGCGGG - Intergenic
1144729756 17:17519595-17519617 CACAGCACTCGGCTGGGGCCTGG + Intronic
1144881569 17:18433249-18433271 CAGAGGCCAGGGATGGGGGTGGG + Intergenic
1144994057 17:19254724-19254746 CTGAGCACTGGAATGGAGGTGGG + Intronic
1145150664 17:20511137-20511159 CAGAGGCCAGGGATGGGGGTGGG - Intergenic
1145203747 17:20969403-20969425 CAATGCACAGGCATGGGGGCGGG + Intergenic
1145978500 17:28997956-28997978 CAGAGCCTGGGGGTGGGGGCAGG - Intronic
1146464539 17:33075725-33075747 CTGAGCACTGGGACAGGTGCTGG + Intronic
1146467013 17:33094308-33094330 CACAGCTCCGGGTTGGGGGCTGG + Intronic
1146689219 17:34861531-34861553 AAGAGCACTGTGCTGGGGGTTGG + Intergenic
1147037381 17:37691872-37691894 CAGGGCACTGACAAGGGGGCAGG - Intronic
1147192982 17:38748123-38748145 CTGGGGATTGGGATGGGGGCCGG - Intronic
1147579006 17:41618167-41618189 CAGAGGCCAGGGATGGGGGTGGG - Intergenic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147586920 17:41658161-41658183 CAGAGGACTGGGTGTGGGGCTGG + Intergenic
1147924166 17:43936347-43936369 AAGAGCTTGGGGATGGGGGCTGG + Intergenic
1148080677 17:44966485-44966507 GAGAGCACTGGGAAGGGAGGTGG + Intronic
1148122603 17:45221842-45221864 CAGAGGGCTGGGCCGGGGGCAGG - Exonic
1148465242 17:47861061-47861083 CAGTGCCCTGGAAAGGGGGCCGG + Intergenic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148794074 17:50188869-50188891 GAGGGTACTGGCATGGGGGCTGG + Intronic
1149408032 17:56374988-56375010 CATAGCACAGGGCTGGGGACAGG + Intronic
1150139537 17:62716535-62716557 CCCAGCTCTGGGATGGGGCCAGG - Intronic
1150226597 17:63527862-63527884 CAGGCCACAGGCATGGGGGCAGG + Intronic
1150479616 17:65499300-65499322 GAGAGGGCTGGGCTGGGGGCTGG - Intergenic
1150572827 17:66402717-66402739 CAGAGCACTGAGATGTTTGCTGG + Intronic
1151362412 17:73596619-73596641 GAGACCACTGGGAAGGGGGTTGG - Intronic
1151452955 17:74210539-74210561 CAGGGTACTGGGATGGGGGGAGG + Exonic
1151539477 17:74757867-74757889 AAGAGCCCTGGGCTGGGGGAGGG + Intronic
1151678216 17:75610674-75610696 CAGGGCACCGGGAAGAGGGCAGG - Intergenic
1151686108 17:75647611-75647633 CCCACCACTGGAATGGGGGCAGG - Exonic
1151751581 17:76041667-76041689 AACAGCACAGGGATGTGGGCAGG - Intronic
1152072746 17:78142051-78142073 CACAGCCTTGGGAGGGGGGCCGG - Exonic
1152164976 17:78697733-78697755 CGATGCACTGGGGTGGGGGCAGG + Intronic
1152228467 17:79103330-79103352 AAGAGGAGTGGGAGGGGGGCAGG + Intronic
1152228634 17:79103895-79103917 CAGACAGCTGGGGTGGGGGCGGG + Intronic
1152355767 17:79806479-79806501 ACGAGCTCTGGGATGGGGGTGGG + Intergenic
1152583749 17:81180157-81180179 GAGAGCAGTGGGATTGGGGGTGG + Intergenic
1152756899 17:82090746-82090768 CAGAGCCTTGTGCTGGGGGCAGG - Intronic
1152863442 17:82709174-82709196 CAGGGACCTGGCATGGGGGCAGG - Intergenic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152941600 17:83175647-83175669 GAGAGAGCTGGGGTGGGGGCAGG - Intergenic
1153810744 18:8749648-8749670 AAGAGCACAGGGATGGGGTTTGG + Intronic
1153963441 18:10159562-10159584 CAGAGCACTTGGATGGAGGAGGG + Intergenic
1154059624 18:11047321-11047343 AATAGCAGTGGGATGGGGGTGGG + Intronic
1154978394 18:21481224-21481246 CTGGGCAGGGGGATGGGGGCAGG + Intronic
1155154027 18:23143677-23143699 CAGAGCACTGGGCTAGGGTGGGG - Intronic
1156111341 18:33730752-33730774 CAGGGCACTTGTATGGGTGCTGG - Intronic
1156456813 18:37299428-37299450 CAGGGGCCTGGTATGGGGGCCGG + Intronic
1156460675 18:37319790-37319812 CAGAGCACTGGGCCTGGGCCTGG + Intronic
1156687433 18:39666785-39666807 GAAAGAACTGGGCTGGGGGCAGG + Intergenic
1157297939 18:46459499-46459521 CAGAGAATTGGGAGGGGGGAGGG - Exonic
1157535571 18:48454975-48454997 CACAGCACTGGCTTGGGCGCTGG - Intergenic
1157537907 18:48474077-48474099 CAGTGGGCTGGGATGGGGGGTGG + Intergenic
1158454085 18:57591425-57591447 CAGAGCCCTGGGAAGATGGCAGG + Intergenic
1158599572 18:58845803-58845825 CAGAGCAGTGTGCTGGGGCCGGG - Intergenic
1158658049 18:59359002-59359024 CGGAGCAGAGGGCTGGGGGCCGG - Intronic
1159793830 18:72817390-72817412 CTGAGCACTGGAATGGCTGCGGG - Intronic
1160335071 18:78031527-78031549 CAGAGAAATGGGCTGGGGGAGGG - Intergenic
1160675131 19:386798-386820 GAGAGCACGGGGTTGGGGGTGGG - Intergenic
1160849506 19:1183613-1183635 CAGAGCAAAGGGCCGGGGGCAGG + Intronic
1160871670 19:1280609-1280631 CAGATCACAGGGTTGGGGGCCGG - Intergenic
1160916404 19:1498912-1498934 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
1161111692 19:2474641-2474663 CGGGGCACTGGGCTGGAGGCGGG - Intergenic
1161224783 19:3138404-3138426 CCGAGCTCTGGGTTGGGGGCTGG + Intronic
1161483681 19:4523636-4523658 CAGAGCACAGGGACGGGAGTGGG - Exonic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1161979662 19:7623973-7623995 CAGAGCACTTGGCTGGGGGCTGG - Intronic
1162743061 19:12783979-12784001 CAGGGCACTGGAATGAGGGTGGG - Intronic
1162780936 19:13006778-13006800 GAGAGCTCTGGGCTGGGGCCCGG + Intronic
1162883468 19:13678093-13678115 CAGAACCCTGGCATGGTGGCGGG - Intergenic
1162891360 19:13735546-13735568 TAGGGGACTGGGCTGGGGGCTGG - Intronic
1162921588 19:13906372-13906394 CAGAGCCCGGGGAAGGAGGCAGG + Exonic
1163455807 19:17405082-17405104 CAGGGCACTGGTGTAGGGGCAGG - Intronic
1163558338 19:18005289-18005311 GAGAGCACAGGGTTGGGGGTAGG + Intronic
1163623520 19:18374640-18374662 CTGAGCACGGGGGTGGGGGCGGG + Intergenic
1164563467 19:29309825-29309847 CTGAGCCCTGGGATGGGAGCAGG - Intergenic
1164599084 19:29549014-29549036 CAGAACACTGGGGTGGGTGGGGG - Intronic
1164622680 19:29706564-29706586 CTGAGCACTGAGATGGAGGTGGG + Intronic
1164891067 19:31824057-31824079 CAGGATACTGGGATGGGGGTGGG + Intergenic
1165655753 19:37530623-37530645 GAGAGCACGGGGTTGGGGGTGGG + Intronic
1165745604 19:38228447-38228469 CAGCGCACGGGGTTGGGGGAAGG + Intronic
1165785990 19:38462391-38462413 CAGGGCACTGGTCTGGGGACAGG - Intronic
1165786791 19:38466449-38466471 CAGAGATCAGGGATCGGGGCTGG - Intronic
1165851440 19:38852194-38852216 CCGAGCAGCGGGGTGGGGGCGGG - Intronic
1166343750 19:42152866-42152888 CAGAGCTCTGGGAGGTGGGCAGG + Intronic
1166747984 19:45151052-45151074 CAGAGCCCTGGGCTGGGGGTGGG - Exonic
1167024325 19:46904122-46904144 GACAGCACTGGGATGGGGGTGGG + Intergenic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
1167913075 19:52720069-52720091 GAGAGCACGGGGTTGGGGGTAGG + Intronic
1168273221 19:55261682-55261704 CAGAGACGTGGGATTGGGGCGGG - Intergenic
925083012 2:1084508-1084530 GAAGGCTCTGGGATGGGGGCAGG + Intronic
925190120 2:1875841-1875863 CAGAGCCCTGGGGTGGGAGAGGG - Intronic
925317188 2:2935581-2935603 CAGAGGCCTTGGATGGGGCCAGG - Intergenic
925935124 2:8750216-8750238 AAGAGCACACGGATGGGGGCTGG + Exonic
926104649 2:10142606-10142628 CTGAGCACTGGAATGGGAGGGGG - Intronic
926150009 2:10420191-10420213 AAAAGCCCTGGGCTGGGGGCTGG - Intronic
926695814 2:15769791-15769813 CAGAGCACTGGGCTGGGGTGGGG - Intergenic
926701371 2:15806276-15806298 CAGAGAGCTGCGATGAGGGCAGG + Intergenic
927115501 2:19897660-19897682 CAGAGCACTGGGGTGGGAATTGG - Intronic
927158518 2:20236326-20236348 CAGTGCCCTGGGATGGAGGCTGG + Intergenic
927850203 2:26494094-26494116 CAGAGCCCTGGGCTGGAAGCTGG + Intronic
927935967 2:27076971-27076993 AACAGCATTGGGGTGGGGGCGGG - Intergenic
928074523 2:28251005-28251027 CAGAGCTGTAGGATTGGGGCTGG + Intronic
928088103 2:28358312-28358334 CAGGGCACTGGGGCGGGGTCGGG - Intergenic
928097556 2:28413741-28413763 GAGTGCACTGGGGTGGGGACAGG - Exonic
928944552 2:36760871-36760893 CTGAGAACTGGGATGGGGTGAGG + Intronic
929110861 2:38404076-38404098 GAGAGCACAGGGTTGGGGGTAGG - Intergenic
929289720 2:40176016-40176038 CAGGGCATTGGGTTGGGGGGAGG + Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929579015 2:43070115-43070137 CAGGGCACAGGTATGTGGGCAGG - Intergenic
930762512 2:55050834-55050856 TAGAGCACTGGGAAAGGGGGCGG + Intronic
930786794 2:55279397-55279419 GAGAGCACGGGGTTGGGGGTAGG - Intergenic
930874183 2:56194861-56194883 CACAGCAATGGGGTGGGGGTGGG - Intronic
931088982 2:58865375-58865397 CAAAGAACTGGGATGAGGGCAGG - Intergenic
931188117 2:59973444-59973466 TAGGTCAGTGGGATGGGGGCTGG + Intergenic
931296155 2:60928028-60928050 CAGGGCACTGGCATGGTGGATGG + Exonic
931731973 2:65161177-65161199 CAGAGGGATGGGATGCGGGCTGG + Intergenic
931743365 2:65269124-65269146 CATATTACTGGGATGGGGGGTGG + Exonic
932569646 2:72931829-72931851 TAGAGCACTGGCATGGGGATGGG - Intronic
932757993 2:74422008-74422030 CAGAGGACGGTGATGGGGGAGGG - Intronic
933530563 2:83505313-83505335 CATAGCACTGGGTTGGGAGTTGG - Intergenic
933807611 2:86011704-86011726 CAGGGCACTGGCATCTGGGCAGG + Intergenic
934520673 2:95018348-95018370 GAAAGCACTGGGCTGAGGGCAGG - Intergenic
934652793 2:96101920-96101942 CAGAGATCTGGGCTTGGGGCAGG - Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935689320 2:105716080-105716102 CAGGGCAGTTGGATGGGGGGTGG - Intergenic
936020045 2:108988029-108988051 CAGAGCAGTGGCCTGGGGACTGG + Intronic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936795343 2:116196536-116196558 CAGCGGAATGGGAGGGGGGCAGG - Intergenic
937353526 2:121184086-121184108 ATGAGGACTGGGATGGGGGCAGG - Intergenic
937915833 2:127098310-127098332 CACAGGACTGGGTTGGGGGCGGG - Intronic
938114408 2:128593642-128593664 CAGAGGAGAGGGATTGGGGCGGG + Intergenic
938116117 2:128603900-128603922 CAGAGCCCTGGGCTGGGCGGTGG - Intergenic
938341443 2:130539186-130539208 CAAGCCACAGGGATGGGGGCTGG + Exonic
938348386 2:130581523-130581545 CAAGCCACAGGGATGGGGGCTGG - Intronic
938800667 2:134760725-134760747 CAGAGGTCTGGGATGTGGCCAGG - Intergenic
938968271 2:136407572-136407594 CTGAGCCCTGGTGTGGGGGCAGG + Intergenic
939211105 2:139175853-139175875 CAGAGCTTCTGGATGGGGGCGGG - Intergenic
939262356 2:139827413-139827435 CAGAACAGTGGGGTTGGGGCTGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942456143 2:176139869-176139891 CAAAGCACGGGTGTGGGGGCGGG + Intergenic
943505707 2:188754252-188754274 CTGAGCATTGGGCTGGGTGCCGG - Intronic
944194065 2:197033615-197033637 AACAGCACAGGGATGGGGGCAGG + Intronic
944361764 2:198865406-198865428 CAGAACACTGGCCTGGAGGCTGG - Intergenic
945832348 2:214803018-214803040 GAGAGCACCGGGTTGGGGGTAGG - Intronic
945866519 2:215182378-215182400 CTGAGCACTCTGACGGGGGCAGG - Intergenic
946164226 2:217854079-217854101 CAGAGGCCTGGGGTGGGGCCAGG + Intronic
946181708 2:217953008-217953030 CTGAGCGCTGGGCTGGGAGCTGG - Intronic
946441765 2:219703027-219703049 CCCAGCACTGGGGTGGGGGATGG - Intergenic
947395620 2:229683948-229683970 CAGAGCACTGTGTTAGGGGCTGG + Intronic
947444167 2:230150673-230150695 TAGAGCACCTGGATGGGGGCTGG + Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947913346 2:233816902-233816924 CAGAGCAGCAGGCTGGGGGCTGG - Intronic
948117134 2:235501778-235501800 TGGAGGATTGGGATGGGGGCGGG - Intronic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948269179 2:236661137-236661159 CAGAGCTCTGAGAGGGGGGTGGG + Intergenic
948763462 2:240207655-240207677 CAGCTTTCTGGGATGGGGGCTGG - Intergenic
948910727 2:241001165-241001187 CACTGCAGTGGGATGGGGGCTGG - Intronic
948977738 2:241473767-241473789 GAGAGCCAGGGGATGGGGGCAGG + Intronic
949006972 2:241655215-241655237 CAGAGGTCAGGGCTGGGGGCGGG + Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1169417027 20:5425988-5426010 CCATGGACTGGGATGGGGGCAGG + Intergenic
1169558161 20:6770243-6770265 CAGAGGGCTGGGATGAGGGGCGG - Exonic
1170075999 20:12419786-12419808 CAGAGAACTGTTGTGGGGGCAGG - Intergenic
1170402454 20:16003020-16003042 CAAGGCACTGGGCTCGGGGCTGG + Intronic
1170664500 20:18375380-18375402 GAGAGCACGGGGTTGGGGGTAGG + Intergenic
1171994261 20:31720122-31720144 CAGATAACTGGGGTGGGGTCAGG - Intronic
1172278764 20:33695792-33695814 CACAGCACTGGGAGGGGAGATGG - Intergenic
1172965231 20:38829706-38829728 CAGGGCACTGGCCTGGGTGCTGG - Intronic
1172965487 20:38831357-38831379 CAGGGCACTGGCCTGGGTGCTGG - Intronic
1173100356 20:40082169-40082191 GAGAGCTTCGGGATGGGGGCTGG + Intergenic
1173182039 20:40813077-40813099 GAGGGCACTGGGATGGGAGAGGG + Intergenic
1173223717 20:41149366-41149388 CAGAGGGCTGGATTGGGGGCTGG + Intronic
1173555814 20:43964794-43964816 CACAGCTCTGGGATAAGGGCTGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173951846 20:46999675-46999697 CAAACCACTGGGGTTGGGGCGGG - Intronic
1174221211 20:48957007-48957029 CAGAGAACAGGGATGTGGGGAGG + Intronic
1174265011 20:49325057-49325079 CAGAGCACTGGGCTGGGTGCTGG - Intergenic
1174401851 20:50280263-50280285 AAGAGCCCTGGGCTGGGGGCAGG - Intergenic
1174441733 20:50561080-50561102 CACAGCAAAGGCATGGGGGCTGG - Intronic
1175216700 20:57395077-57395099 CAGTGCACAGGCATGTGGGCTGG + Intronic
1175273764 20:57753689-57753711 CAGAGCTCTGGGCTGTGGCCTGG - Intergenic
1175313483 20:58028213-58028235 AGGAGCACTGAGTTGGGGGCAGG - Intergenic
1175584247 20:60125203-60125225 CAGGGCTCTGTGCTGGGGGCGGG + Intergenic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175767775 20:61603169-61603191 CAGGGCACTGGGGTGTGGCCAGG + Intronic
1175816308 20:61884819-61884841 GAGAGCCCTGGGGTGGGGGCGGG + Intronic
1176129028 20:63488470-63488492 CAGAGCCCTGGGGTTGGGGGGGG - Intronic
1176195468 20:63834822-63834844 CAGAGCACCTGGAATGGGGCTGG - Intergenic
1176207247 20:63895566-63895588 CTGAGCACCGTGGTGGGGGCTGG + Intronic
1176249840 20:64115345-64115367 GAGCACACTGGGATGGGGACAGG - Intergenic
1176521720 21:7829625-7829647 CGCTGCACAGGGATGGGGGCGGG + Intronic
1176838716 21:13820006-13820028 GAGAGCACGGGGTTGGGGGTAGG - Intergenic
1178089706 21:29149667-29149689 CAGAGAACTGGGGAAGGGGCAGG - Intronic
1178417903 21:32418684-32418706 CAGAGTACAGGGATGGGGCCAGG + Intronic
1178482819 21:32994428-32994450 CAGATAAATGGGATGGGGGTGGG + Intergenic
1178655740 21:34459637-34459659 CGCTGCACAGGGATGGGGGCGGG + Intergenic
1179153916 21:38832989-38833011 CCCAACACTGTGATGGGGGCCGG + Intergenic
1179519274 21:41931767-41931789 GATAGCACCAGGATGGGGGCTGG + Intronic
1179565965 21:42249204-42249226 CAGGGGACTGGGATGAGGGAGGG + Intronic
1179786948 21:43735515-43735537 CAGGGGACTGGGATGAGGACAGG + Intronic
1179809230 21:43859605-43859627 CTGACCCCTGGGATGGGGGATGG + Intergenic
1179884323 21:44306985-44307007 CAGAGCACGGGCCTGGGGGCAGG + Intronic
1180042359 21:45287261-45287283 CCGAGGGATGGGATGGGGGCGGG - Intronic
1180042463 21:45287499-45287521 CAGGGGAATGGGATGGGGTCAGG - Intronic
1180172376 21:46066330-46066352 CAAAGCGCTGTGTTGGGGGCCGG + Intergenic
1180304922 22:11066469-11066491 CTGAGCAGTAGGATTGGGGCTGG + Intergenic
1181031078 22:20149130-20149152 CAGGGCCCTGGGTGGGGGGCTGG + Intronic
1181275959 22:21687800-21687822 CAGGGCCCTGGGATGGGGCAGGG - Intronic
1181466491 22:23113301-23113323 CAGAGTGCTGGGGTGGGAGCCGG - Intronic
1181531437 22:23519742-23519764 AAGAGCACTGGACTGGGGTCAGG - Intergenic
1181695244 22:24589742-24589764 CAGAGCCCAGGGCTGGGGACTGG - Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1181894349 22:26093668-26093690 CAGAGCACTGATGTGGGAGCTGG + Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182277889 22:29201953-29201975 CAGAGAGCTGGGACTGGGGCTGG - Intergenic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1182697637 22:32207309-32207331 CAGAGCAGTAGGAGGGCGGCTGG + Intergenic
1182715233 22:32352822-32352844 CAGAGCGGTAGGATGGCGGCTGG - Intergenic
1182866184 22:33606577-33606599 GAGAGCACGGGGTAGGGGGCGGG - Intronic
1183373254 22:37447689-37447711 CTGAGCACTGGGATGCCAGCTGG + Intergenic
1183724563 22:39581228-39581250 CAGAGAAGTGGGATGGGGCATGG + Intronic
1183926631 22:41211014-41211036 AGGAGGACTGGGTTGGGGGCGGG + Intronic
1184068114 22:42131657-42131679 CAGAGCCCAGGAATGTGGGCTGG - Intergenic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184191816 22:42900027-42900049 CAGAGAGCTGAGATGGGGGCAGG - Intronic
1184405630 22:44298923-44298945 CAGAGCCCTGGGCTGGGAGCCGG + Intronic
1184468832 22:44684152-44684174 GTGGGCACTGGGGTGGGGGCTGG - Intronic
1184992703 22:48181672-48181694 CAAAGCACAGGGAGGAGGGCAGG + Intergenic
1185320186 22:50197121-50197143 CACAGCACTGGGCTGGGGCAGGG + Intronic
1185361977 22:50413824-50413846 CAGGCTACTGGGCTGGGGGCTGG - Intronic
1185389211 22:50549745-50549767 CAGTGCAGTGGGGCGGGGGCGGG - Exonic
1185415188 22:50705695-50705717 CAGAGCCATGGGGTGGGGGCTGG - Intergenic
950473318 3:13199722-13199744 CGGAGGACTCAGATGGGGGCAGG - Intergenic
950478792 3:13232003-13232025 CAGTGCACTAGGTTGGGGCCCGG - Intergenic
950819678 3:15743071-15743093 GAGAGCACAGGGTTGGGGGTAGG - Intronic
951847798 3:27103380-27103402 CAGAATCCTGGGATGGGGACTGG + Intergenic
952403953 3:32988984-32989006 AAGATCACTGGGGTGGGGGTGGG + Intergenic
953259478 3:41323667-41323689 CAGGACACTGGGAGGGGGGTCGG - Intronic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
954111730 3:48437369-48437391 CAGGGCCCAGGGTTGGGGGCTGG - Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954482030 3:50808614-50808636 CAGAGCACTTGGGTTGGAGCTGG - Intronic
954630562 3:52045575-52045597 GACAGCCCTGGGAAGGGGGCTGG + Intergenic
955444009 3:58988494-58988516 CAGAGCATTGAGATGGGAACAGG + Intronic
956852716 3:73245519-73245541 AAGAGCAGTGGGATGGGTGTGGG - Intergenic
957789367 3:84919213-84919235 GAGAGCACAGGGTTGGGGGCAGG - Intergenic
961206527 3:125086812-125086834 CAGGGCCCAGGGATGGAGGCTGG - Intronic
961215971 3:125160861-125160883 CAGAGCACTGGCTGGGGAGCTGG + Intronic
961361490 3:126370898-126370920 CTGGGCTCTGGGCTGGGGGCTGG - Intergenic
961455197 3:127020548-127020570 CTGAGCCCTGGGGTTGGGGCAGG + Intronic
961517773 3:127448947-127448969 CAAAGCACTGGGGTGGTGCCTGG - Intergenic
961537445 3:127578759-127578781 CAGAGGAGTGGGCTGTGGGCAGG - Intronic
961880365 3:130057412-130057434 GAGAGCACAGGGTTGGGGGTAGG - Intergenic
962311090 3:134327401-134327423 TCCAGCACTGGGATGGGAGCCGG - Intergenic
962366557 3:134789854-134789876 CAGAGAATTGGGATGGTGGTTGG - Intronic
962373355 3:134839666-134839688 CAGTGCCCTGGGATAGGGTCTGG + Intronic
962458103 3:135583882-135583904 CTGAGCAGTGCCATGGGGGCTGG - Intergenic
962572455 3:136724299-136724321 GAGAGCACAGGGTTGGGGGTAGG - Intronic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
963468234 3:145710070-145710092 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
963845538 3:150152496-150152518 CAGAGCTGAGGGATGGGGGATGG - Intergenic
965287600 3:166837276-166837298 TATAGCTCTTGGATGGGGGCTGG + Intergenic
965608896 3:170524392-170524414 ATGAGCACTGTGATGGGGGTAGG + Intronic
966246042 3:177809005-177809027 CTGGGCACGGGGGTGGGGGCGGG + Intergenic
966882645 3:184358952-184358974 GTGAGAACTGGGGTGGGGGCAGG - Intronic
968040804 3:195587677-195587699 AAGAACACTGGACTGGGGGCAGG + Intergenic
968384801 4:126071-126093 AAGAGCCATGGGGTGGGGGCAGG - Intronic
968647800 4:1748999-1749021 GAGAGCAGTGGGGAGGGGGCAGG - Intergenic
968715243 4:2153335-2153357 AAGAGCACTGGGATTGAGGGTGG + Intronic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
969202518 4:5617232-5617254 TAGAGAACTGGGCTGGGAGCTGG - Intronic
969554630 4:7898082-7898104 CAGAGCACTATGATGAAGGCTGG - Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
970963583 4:21901883-21901905 CAGATCAATGGGATCGGGGAGGG - Intronic
974338572 4:60584488-60584510 AGGAGCAATGGGGTGGGGGCTGG + Intergenic
975867265 4:78736851-78736873 CAGTGCACTAGGATGGTGCCTGG + Intergenic
977258313 4:94764892-94764914 GGGAGGACTGGGAAGGGGGCAGG + Intronic
977295449 4:95203996-95204018 CAGGGAGCTGGGATGAGGGCAGG + Intronic
978747797 4:112213326-112213348 CAGATCACTGGCCTGGGGGTGGG - Intergenic
978765334 4:112399525-112399547 CAGAGAAATGGGATAGGAGCTGG + Intronic
979192269 4:117876417-117876439 CAGAGCACAGGGGCAGGGGCTGG - Intergenic
979337523 4:119480334-119480356 CAGACCTCTGGAATGGTGGCTGG + Intergenic
979641336 4:123015483-123015505 GAGAGCACAGGGTTGGGGGTAGG + Intronic
980019139 4:127687767-127687789 CTGAGCACTGGGACTGGCGCTGG - Exonic
981098577 4:140806700-140806722 CACAGATCTGGGATGGGGACCGG - Intergenic
982075483 4:151732415-151732437 CAGAGCACAGGGTTGGGGGCAGG - Intronic
982129450 4:152214695-152214717 CAGAAGACTGGGATGAGGGGTGG + Intergenic
982481758 4:155920758-155920780 CAGACCACAGGCATGGGAGCTGG - Intergenic
982711485 4:158762436-158762458 CAGAACTGTGGGATGGGGGTGGG + Intergenic
982875888 4:160649125-160649147 CAAAGCACTGGAGTAGGGGCAGG + Intergenic
984004642 4:174294342-174294364 GAGAGCACAGGGTTGGGGGTAGG + Intronic
984713286 4:182903690-182903712 CAGGGCCCTGGGCTGTGGGCAGG - Intronic
984713498 4:182905063-182905085 CAGAGAAGTGGGGTGGTGGCTGG - Intronic
985078065 4:186237807-186237829 CAGAGAGGTGGGAAGGGGGCGGG - Intronic
985706475 5:1404214-1404236 CGGAGGACTGGGATGGGGGCTGG + Intronic
986224655 5:5801502-5801524 CTGTGCAGTGGGATGGAGGCTGG + Intergenic
986299343 5:6466062-6466084 CAGGGCCCTGGGAGGGTGGCAGG - Intronic
986436813 5:7742251-7742273 CATAGCTCTGAGATGTGGGCTGG + Intronic
987650824 5:20738309-20738331 CAGAGAACTGCCATGGGGACAGG - Intergenic
987732354 5:21791160-21791182 CAGAGCACTGGGAAGATGCCAGG - Intronic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988744733 5:34123154-34123176 CAGAGAACTGCCATGGGGACAGG + Intronic
988774625 5:34466822-34466844 GAGGGCACTGGGATGTGGACTGG + Intergenic
989103633 5:37841050-37841072 CAGAGCTCTGGAATGGGGGCCGG - Intergenic
990355167 5:54959990-54960012 CAGGGAACTGGCCTGGGGGCTGG - Intergenic
990381365 5:55224205-55224227 GACAGCACTGGGAAGGGGACAGG + Intronic
990475346 5:56157123-56157145 GCGAGCACAGGGATGGGGGTAGG - Intronic
991373477 5:65941012-65941034 GAGAGCACAGGGTTGGGGGTAGG - Intronic
991723353 5:69514823-69514845 GAGAGCACAGGGTTGGGGGTAGG + Intronic
992348714 5:75907465-75907487 CAGCGCGGTGGGATGGGGGGAGG + Intergenic
992391554 5:76335720-76335742 GAGAGCACAGGGTTGGGGGTAGG + Intronic
992415695 5:76550652-76550674 GAGAGCACGGGGTTGGGGGTAGG + Intronic
992963925 5:81982862-81982884 GAGAGCACAGGGTTGGGGGTAGG + Intronic
993162603 5:84311858-84311880 GAGAGCACAGGGTTGGGGGTAGG + Intronic
993227998 5:85194366-85194388 CAGAGTACTAGGATGGGGCAGGG - Intergenic
993383393 5:87233807-87233829 CACATCACTGGGATGTGGGAAGG - Intergenic
995894976 5:117002063-117002085 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
995942120 5:117599276-117599298 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
996548581 5:124706993-124707015 CAGAGGGCTGGGTTGGGGGCGGG + Intronic
997844069 5:137270053-137270075 CACAGCACTGGGATCGTGCCGGG - Intronic
998485074 5:142494871-142494893 AAGAGTATTGGGATGGGGGCAGG + Intergenic
999054283 5:148557161-148557183 CAGAGTAATGACATGGGGGCAGG + Intronic
999236830 5:150103657-150103679 CAGAGCAGTGGCATTGGAGCTGG + Intronic
999323157 5:150626990-150627012 CACAGCTCTGGGAGGTGGGCAGG + Intronic
999696712 5:154193440-154193462 CAGTACACTGGGATGAGGGATGG - Intronic
999891290 5:155981111-155981133 CAGCCCACTGAGATGAGGGCTGG + Intronic
1000941574 5:167368796-167368818 CAGAGGCCTGGGGTGGGGGTAGG - Intronic
1001120596 5:168976957-168976979 CACAGAGCTGGGGTGGGGGCTGG + Intronic
1001322854 5:170697214-170697236 TGGTGCTCTGGGATGGGGGCAGG - Intronic
1001416245 5:171546394-171546416 CAGAGCTCCAGGATGTGGGCCGG - Intergenic
1001484075 5:172107067-172107089 CAGAGTCCTGGGGAGGGGGCGGG + Intronic
1001582352 5:172807423-172807445 CTGAGATCTGGGCTGGGGGCTGG - Intergenic
1001690016 5:173625945-173625967 CAGAGCACTGAAATGGAGGTAGG - Intergenic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002495316 5:179607673-179607695 CAGGGCACTGGGAGGGTGGGTGG - Intronic
1002523524 5:179803924-179803946 CAGAGCCCTGGCATAGGGCCTGG - Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003127064 6:3363819-3363841 GAGAGGACCAGGATGGGGGCAGG - Intronic
1004664018 6:17734968-17734990 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
1005250076 6:23935279-23935301 CAGAGCCCAGGGATGGGAGTGGG + Intergenic
1005407017 6:25500163-25500185 CAGAGCACTGTTATTGGGCCTGG + Exonic
1006295319 6:33167567-33167589 CAGAGGAGTGGGGTGTGGGCAGG + Intronic
1006834118 6:36986342-36986364 CAGGACACTGGGCTGCGGGCCGG + Intergenic
1007315342 6:40983787-40983809 CTCTGGACTGGGATGGGGGCAGG - Intergenic
1007376489 6:41460311-41460333 CAGAGCCCTGGGAGGGGAGATGG - Intergenic
1007655823 6:43450529-43450551 CACAGCACTGTGATGGAGGTGGG - Exonic
1007785642 6:44277787-44277809 CAGCGCCCTGGGGTGGTGGCAGG - Exonic
1007789144 6:44299029-44299051 CAGTGAGCTGGGATAGGGGCAGG - Intronic
1008088047 6:47264791-47264813 AAAGGCAGTGGGATGGGGGCGGG + Intronic
1008536897 6:52513128-52513150 CAGAGCAGTGGGAGTGTGGCTGG - Intronic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1010781196 6:79947520-79947542 CAGCGCACTGTGCTGGCGGCTGG - Exonic
1011915833 6:92505888-92505910 AAGAGAACTGGAATGGGGGTTGG + Intergenic
1011955213 6:93017232-93017254 CAGTGCACTGAGGTGGGGGAGGG - Intergenic
1012499045 6:99868617-99868639 GAGAACACTGGGCTGGGAGCTGG + Intergenic
1013162117 6:107554846-107554868 CAGAGGGCTGGGATGGGGGGTGG + Intronic
1013206994 6:107954162-107954184 GAGAGCACAGGGTTGGGGGTAGG - Intronic
1013681181 6:112527960-112527982 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
1014374305 6:120653322-120653344 GAGAGCATTGTGATGGGGACAGG - Intergenic
1014799548 6:125762844-125762866 CAGAACACTTGGATGGGAGATGG - Intergenic
1017468969 6:154720939-154720961 CAGAGCACTGGGATTATGGGTGG + Intergenic
1017724360 6:157266883-157266905 CAGAGCACAGGCATGGGCGATGG - Intergenic
1018153524 6:160963290-160963312 CACAGCCCTGGGCTGGGGGCTGG - Intergenic
1018252193 6:161882321-161882343 CACAGCAACGGCATGGGGGCGGG + Intronic
1018389282 6:163330266-163330288 CAGAACACTGGGAGGGGGCGAGG - Intergenic
1018558418 6:165074358-165074380 CAGTGCTGTGGGATGGGGACAGG - Intergenic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1018924391 6:168196080-168196102 CTGAGCCCTAGGACGGGGGCTGG + Intergenic
1019205997 6:170362443-170362465 CAGAACACTGGGAGAGTGGCAGG - Intronic
1019712424 7:2523748-2523770 CTGAGCAGTGGGAGGGGTGCTGG + Intronic
1020000919 7:4755102-4755124 GAGGGCACTGGGACGGGTGCCGG + Intronic
1020128303 7:5545479-5545501 CAGAGCCCTGGGCTGTGTGCAGG + Intronic
1020675396 7:11178098-11178120 GAGAGCAGTAGGGTGGGGGCTGG + Intergenic
1021340932 7:19461821-19461843 CAGAGGACTGGGGTGGGGTATGG - Intergenic
1021958858 7:25852742-25852764 CTGGGCGCTGGGGTGGGGGCGGG + Intergenic
1022095684 7:27139670-27139692 CGGAGCCCTGGGGTCGGGGCTGG - Intronic
1022221861 7:28321629-28321651 GAGATCACTGGGCTAGGGGCAGG + Intronic
1022248784 7:28586334-28586356 CAGAGCTCTGGGAGGGGCCCAGG + Intronic
1022274931 7:28846064-28846086 CACAGCCCTGGAATGTGGGCGGG + Intergenic
1022465321 7:30649430-30649452 CAGGGCAGGGGGCTGGGGGCAGG + Intergenic
1023217851 7:37884582-37884604 CAGAGGATTGGGATGGGAGCAGG - Intronic
1024539058 7:50460745-50460767 GAGAGCACAGGGTTGGGGGTAGG - Intronic
1024647034 7:51379532-51379554 AAGAGCACTGGCTTGGGGACAGG - Intergenic
1024943502 7:54785749-54785771 CAGGGCACTAGGAAGGGGGTGGG - Intergenic
1025275707 7:57580139-57580161 TAGAGCAGTAGGATGGTGGCCGG + Intergenic
1026492443 7:70874416-70874438 GGGAGCACTGGGATGGTGGCAGG - Intergenic
1027130114 7:75584720-75584742 AAGAGGACTGGGATGGGAGCTGG - Intronic
1027195839 7:76029529-76029551 CAGGGCAGTGGGCTGGGGGGCGG + Intronic
1027224208 7:76233936-76233958 CAGAGTGATGGGATGGGGGTGGG - Intronic
1027266626 7:76498351-76498373 CAGAGCCCTGGGCTGGGGGCAGG - Intronic
1027267761 7:76503636-76503658 CAGACTGCTGGGATGTGGGCGGG - Intronic
1027318007 7:76996469-76996491 CAGAGCCCTGGGCTGGGGGCAGG - Intergenic
1027970958 7:85080708-85080730 CAGAGCACTCGGATGAGGAGAGG + Intronic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1028608687 7:92683696-92683718 CAGAGGACTGTGGTGGGGGGGGG + Intronic
1029148479 7:98463557-98463579 CAAAGCACTGGGTTGGGGAGGGG + Intergenic
1029538121 7:101167511-101167533 GAGAGCAGTGGGATGGGGAGGGG + Intergenic
1029619618 7:101681792-101681814 CAGGGCACAGGGATGGGGAGGGG - Intergenic
1030454844 7:109760460-109760482 CACAGCAATGGGCTGGGGGTGGG + Intergenic
1030714121 7:112789150-112789172 GTGAGCACTGGGGTGGGGCCAGG - Intronic
1031924832 7:127629440-127629462 CAGAGCACTGGGTAGGCTGCAGG - Intergenic
1031966085 7:128029587-128029609 CAGAGCACTGGAAGGAGGCCTGG + Exonic
1032042651 7:128576309-128576331 GAGAGCACAGGGTTGGGGGTAGG + Intergenic
1032079089 7:128849767-128849789 GACAGCACTGGGCAGGGGGCAGG - Intronic
1032164004 7:129531693-129531715 CAAAGGACTGGGGTGGTGGCCGG - Intergenic
1032388039 7:131538150-131538172 CAGAGCACAGGGGAGGGGCCAGG - Intronic
1033131684 7:138750689-138750711 CAGAGCGCTGGGAGGCTGGCCGG - Intronic
1033731720 7:144187226-144187248 CAGAGAGTTGGGATGGGGGCAGG - Exonic
1033742570 7:144285809-144285831 CAGAGAGTTGGGATGGGGGCAGG - Intergenic
1033751333 7:144363805-144363827 CAGAGAGTTGGGATGGGGGCAGG + Exonic
1034895600 7:154874633-154874655 CTGAGGAGTGGGGTGGGGGCAGG - Intronic
1034962199 7:155369920-155369942 CAGAGCAATGGGCTGCGGCCAGG - Intergenic
1034974822 7:155441937-155441959 CAGAGCCCTGGGAGGGGGGAGGG - Intergenic
1035028493 7:155842684-155842706 GTCAGCACTGAGATGGGGGCAGG + Intergenic
1035277132 7:157754346-157754368 CAGTGCTCTGAGCTGGGGGCAGG + Intronic
1035319162 7:158017411-158017433 CCAAGCACTGGGATGGAGCCTGG - Intronic
1035644169 8:1205687-1205709 CGGAGCACTGGGATTCGGACAGG + Intergenic
1035690554 8:1556933-1556955 CAGCACAGCGGGATGGGGGCTGG + Intronic
1035690576 8:1557027-1557049 CTCAGCACGGGGGTGGGGGCTGG + Intronic
1035972058 8:4259424-4259446 CATAGCGCTGGGATGGGTCCTGG - Intronic
1036222049 8:6929327-6929349 CAGGACACTGTGCTGGGGGCAGG - Intergenic
1036442963 8:8797561-8797583 CACTGCCCGGGGATGGGGGCAGG + Intronic
1036772446 8:11588431-11588453 TAGAGCACTGGGGCGGGGACTGG + Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037059992 8:14496009-14496031 CAGAACACTGCAATAGGGGCTGG + Intronic
1037510332 8:19576077-19576099 CAGAGAACAGGGATGGGGTGTGG - Intronic
1037963682 8:23117561-23117583 CACAGGGCTGGGCTGGGGGCTGG - Intergenic
1037992034 8:23328073-23328095 GAGAGCACTGGGTTAGGAGCTGG + Intronic
1038296132 8:26291957-26291979 CAGAGGGGTGGGGTGGGGGCGGG + Intronic
1038349428 8:26762770-26762792 CAGAGCTCTGAGATGGGGCGTGG - Intronic
1039881481 8:41627952-41627974 CAGTGCAGTGGGATGGGTGTGGG - Intergenic
1039915902 8:41860115-41860137 GAAACCACTGGGGTGGGGGCTGG + Intronic
1039957682 8:42219776-42219798 CAAAGCACTGGGATTGTAGCCGG - Intergenic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1040530795 8:48265014-48265036 CAGAACACTGCCATGGGGCCAGG + Intergenic
1040582263 8:48707642-48707664 CAGAGCACAGGGCAGGGTGCAGG + Intergenic
1041441232 8:57899142-57899164 CAGAGAGCTGGGATGAGGGCAGG - Intergenic
1042109835 8:65368858-65368880 CAGAGAACAGGGAGGGGGGAGGG + Intergenic
1043479561 8:80639088-80639110 CAAAGTTCTGGGATGGGGGATGG + Exonic
1044821533 8:96158977-96158999 AAGAGCTCGGGGCTGGGGGCGGG + Intronic
1045249702 8:100473254-100473276 CAGAGCAGTGGGAAGGGAGGAGG + Intergenic
1048470539 8:134700522-134700544 CCGAGCACTGGGGTGGAGGGAGG - Intronic
1049268407 8:141681628-141681650 CAGCGCTCTGTCATGGGGGCTGG - Intergenic
1049351062 8:142165072-142165094 CAGAGCACTGGCTAGGGCGCAGG + Intergenic
1050810862 9:9745791-9745813 AAAAGCACTGTGATGGGGTCAGG - Intronic
1051153731 9:14116263-14116285 CACTGCACTGGGATGGGGAGAGG + Exonic
1051658194 9:19402704-19402726 CAGAGCACTGGGGGGAGGGAGGG - Intergenic
1051724792 9:20078035-20078057 CACAGCTCTGGGATGGGGTTGGG + Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1052889584 9:33685930-33685952 CTGAGCACTGGGAAAGGGGTGGG + Intergenic
1053007710 9:34615022-34615044 TATAGCACTGGGGTGGGGGTAGG - Intronic
1053200826 9:36150632-36150654 AAGAGCACTGGCCTGGGGTCAGG - Intronic
1053885926 9:42645213-42645235 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1054074991 9:60520495-60520517 CAGAACACTGGGATGAAGGCCGG - Intergenic
1054224944 9:62452662-62452684 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1055006258 9:71510690-71510712 CATATCACTGGGGTGGGGGTTGG + Intergenic
1055067108 9:72130049-72130071 CAGTGCATTGTGCTGGGGGCAGG - Intronic
1056136302 9:83632391-83632413 CCGAGCACTGGGCTGGGAGTCGG + Intronic
1056567731 9:87789645-87789667 CAGAGCACAGGGACAGGGCCGGG + Intergenic
1056873126 9:90303730-90303752 CTGAGCACTTGGATGTGGGTGGG - Intergenic
1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG + Intergenic
1057873639 9:98736425-98736447 CACAGCAGTGTGACGGGGGCAGG + Exonic
1058848921 9:108991187-108991209 CAGAGAACTGGGAAGGGGTGAGG + Intronic
1058851387 9:109014410-109014432 CAGAGCCCCACGATGGGGGCGGG + Intergenic
1059308052 9:113370041-113370063 CAGAGCACTGTGCCGGAGGCTGG - Exonic
1059431874 9:114255292-114255314 CTGACCACTGGGAGGGAGGCCGG - Intronic
1059451827 9:114376020-114376042 GAGAGCCCTGGGATAGAGGCTGG - Intronic
1059460386 9:114425894-114425916 CACAGATCTGGGATGAGGGCAGG + Intronic
1059657531 9:116369786-116369808 CAGGGAACTGGGTTGGGGGATGG - Intronic
1059725182 9:117001529-117001551 CAGAGCACTGGGAGAGTGGCAGG - Intronic
1060053624 9:120394225-120394247 CAGAGCACTGGGGTGGGAGTTGG - Intronic
1060211311 9:121712152-121712174 GAGGGCACTGGGTTGGGGGCTGG + Intronic
1060474000 9:123971463-123971485 CACAGGGCTGGGATGGGTGCAGG + Intergenic
1060480071 9:124012495-124012517 CTGAGAGCTGGGATGGGGCCGGG + Intronic
1060869852 9:127030770-127030792 CAGAGGGGTGGGATGGGGGCAGG + Intronic
1060892463 9:127197492-127197514 CAGAGCATGGGGGTGGGGGGCGG + Intronic
1060892597 9:127198278-127198300 CTGAGCACTGGGAAAGGGGGAGG - Intronic
1061817724 9:133206621-133206643 CAGAGCTCTGGGGTGGGGCCGGG + Intronic
1062337852 9:136080256-136080278 GAGAGCACAGAGATGGGTGCGGG - Intronic
1062402137 9:136377454-136377476 TGGAGCAGTGGGGTGGGGGCTGG - Intronic
1062457097 9:136644995-136645017 CAGAGCCCTGGGAAAGGGTCAGG - Intergenic
1062522770 9:136965298-136965320 CACAGCAGTGGCCTGGGGGCAGG + Intergenic
1062540843 9:137041009-137041031 GAGAGCACTGGGCTAGGGACAGG + Intronic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186822133 X:13300313-13300335 CAGGGGATTGGGATGGGGGTGGG - Intergenic
1187552640 X:20321614-20321636 CAGAGCCCTGAAATGGGGACAGG + Intergenic
1187570517 X:20496226-20496248 CATAGCACTGGGGTGGTGGGAGG + Intergenic
1188388488 X:29591098-29591120 CAGAGCAGTGGGAGGGGAGATGG + Intronic
1188454091 X:30342522-30342544 AAGAGCACTGGGGTGGGGCAAGG - Intergenic
1189110005 X:38279526-38279548 GAGAATGCTGGGATGGGGGCTGG + Intronic
1189127540 X:38463888-38463910 CAGAGCCCTGGGGTGGCTGCTGG + Intronic
1189515126 X:41705887-41705909 CAGACCACGGGGAGGGGTGCCGG - Intronic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1190234791 X:48607060-48607082 CAAATCACTGGGCTTGGGGCTGG - Exonic
1190583783 X:51916876-51916898 TAGGTCACTCGGATGGGGGCAGG + Intergenic
1190713886 X:53088245-53088267 CACAGCACAGGGAGAGGGGCTGG - Exonic
1190774197 X:53539614-53539636 CAGACCACTGGGTTGGGACCTGG + Intronic
1194522453 X:94935751-94935773 CAGAGCAGGGGTATGGGGGTCGG - Intergenic
1195443187 X:104921238-104921260 CAAAGCTCTGGGGTGGGGGTGGG - Intronic
1195858038 X:109351782-109351804 CAGAGCACTGCGATTATGGCAGG - Intergenic
1195942358 X:110176680-110176702 CTGTGCACTGGTATTGGGGCAGG + Exonic
1196016470 X:110944937-110944959 GGGAGCTCAGGGATGGGGGCGGG + Intronic
1196791271 X:119467590-119467612 CAAAGGACTGGGCTGGGGGTGGG - Intergenic
1196862763 X:120043166-120043188 CAGGGCACTGGGGTGGGAGGAGG - Intergenic
1196880339 X:120193178-120193200 CAGGGCACTGGGGTGGGAGGAGG + Intergenic
1196950102 X:120868465-120868487 TGGGGAACTGGGATGGGGGCAGG + Intergenic
1197705036 X:129628827-129628849 CAAAGGACTGAGGTGGGGGCAGG + Intergenic
1199991095 X:152988167-152988189 CAGTACACTGGGAAGGGAGCAGG + Intergenic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200337643 X:155366911-155366933 AAGAGGAATGTGATGGGGGCGGG - Intergenic
1200348827 X:155474316-155474338 AAGAGGAATGTGATGGGGGCGGG + Intergenic