ID: 1052835363

View in Genome Browser
Species Human (GRCh38)
Location 9:33246191-33246213
Sequence GGCCTCCTGGGAATGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052835357_1052835363 -9 Left 1052835357 9:33246177-33246199 CCCAGGGAGAGAGGGGCCTCCTG No data
Right 1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG No data
1052835356_1052835363 -8 Left 1052835356 9:33246176-33246198 CCCCAGGGAGAGAGGGGCCTCCT No data
Right 1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG No data
1052835355_1052835363 -7 Left 1052835355 9:33246175-33246197 CCCCCAGGGAGAGAGGGGCCTCC No data
Right 1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG No data
1052835349_1052835363 11 Left 1052835349 9:33246157-33246179 CCAGGGAGAGTTCAGGAGCCCCC No data
Right 1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG No data
1052835358_1052835363 -10 Left 1052835358 9:33246178-33246200 CCAGGGAGAGAGGGGCCTCCTGG No data
Right 1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG No data
1052835345_1052835363 29 Left 1052835345 9:33246139-33246161 CCTGATAGATCATGCAGGCCAGG No data
Right 1052835363 9:33246191-33246213 GGCCTCCTGGGAATGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052835363 Original CRISPR GGCCTCCTGGGAATGATGGG TGG Intronic