ID: 1052838058

View in Genome Browser
Species Human (GRCh38)
Location 9:33265871-33265893
Sequence AAACAGTGGTTCACAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 709
Summary {0: 1, 1: 0, 2: 5, 3: 89, 4: 614}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052838058 Original CRISPR AAACAGTGGTTCACAAAGAA GGG (reversed) Intronic
901926847 1:12571453-12571475 GAACAGTGGTTCTCAAAGTGAGG + Intronic
903161781 1:21494257-21494279 AAACACTGGTTCCTAAGGAAGGG + Intergenic
903488642 1:23710514-23710536 ACACAGTGGTTCTCAAAGCTTGG - Intergenic
903532625 1:24043420-24043442 GAACATTGGTTAACAAGGAAGGG - Intergenic
903629026 1:24752304-24752326 AAACAGTGGTTCAAATATGATGG + Intronic
904843633 1:33391212-33391234 AGACAGTGGTTCTCAAAGTGTGG - Intronic
905956904 1:42004701-42004723 GAGCAGTGGTTCTCAAAGTATGG + Intronic
907344541 1:53764042-53764064 GAACACTGGTTCTCAAAGTATGG + Intergenic
907724991 1:57011494-57011516 AGGCAGTGGTTCTCAAAGGATGG + Intronic
907937543 1:59056371-59056393 GAACAGTTGTGCACAAAGATTGG - Intergenic
908620820 1:65977172-65977194 ATGCAGTGGTTCACAAATATTGG + Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909162391 1:72169721-72169743 AAACAGTGGGTCAGAAGGAAAGG - Intronic
909533239 1:76704671-76704693 AAACTGTGTTTTACAAAAAAGGG - Intergenic
909843909 1:80365940-80365962 AAACAGTGCTTCAGAAAAAATGG + Intergenic
910500221 1:87881987-87882009 TAATAGTGGTTCACAGAGGAAGG + Intergenic
910516498 1:88067233-88067255 ATACAATTGTTGACAAAGAATGG - Intergenic
910731875 1:90406510-90406532 AAACAGTGGTTCTCAAATCTGGG + Intergenic
911287729 1:96017780-96017802 ATACAGTGGTTCACAAATGAGGG - Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912483510 1:110004490-110004512 AAAAAGTGTTTCCCAAAGAAAGG - Intronic
912628233 1:111223696-111223718 CCACAGTGGTACAGAAAGAATGG - Intronic
912744450 1:112233576-112233598 AAACAGTGGTATACCAAGGATGG + Intergenic
913308179 1:117454645-117454667 AAACAGATTTACACAAAGAAGGG + Intronic
914727483 1:150340078-150340100 GAACAGTGGCTGACAAAGAAGGG - Intronic
915194013 1:154175633-154175655 AAACAGAGGTTCTCTAAGTAAGG - Intronic
915656784 1:157367260-157367282 AAAAAGAGGTTCACAACCAAGGG + Intergenic
915685881 1:157633603-157633625 GAACAGTGGTTATCAAAGATTGG + Intergenic
916306793 1:163344662-163344684 AAACATTGCTTCACAAAAGATGG - Intronic
916831584 1:168497761-168497783 AAATAGTGGTTCAGAGGGAAAGG + Intergenic
917195453 1:172460017-172460039 AGACAGTGGTTGTCAAAGATTGG + Intronic
917335531 1:173920929-173920951 AATCAGTGCTTCCCAAAGCATGG - Intergenic
917539670 1:175900458-175900480 ACACAATGGTTCAGAAGGAATGG - Intergenic
918915099 1:190625284-190625306 AACCAGGGCTCCACAAAGAATGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919127281 1:193410381-193410403 TCACAGTGGTTCACAAAGTATGG - Intergenic
919351762 1:196465921-196465943 AATGAGTGGTACACAAATAATGG - Intronic
919871442 1:201824762-201824784 AAGCAGTGGTTCGCAAAGTATGG + Exonic
920015216 1:202901790-202901812 CAACAGTGTTTCACACTGAATGG + Intronic
920222552 1:204414647-204414669 GAAAAGTGGTTCCCAAAGTATGG + Intergenic
920668982 1:207988616-207988638 AAACAAAGGTGCACAAATAATGG - Intergenic
920944776 1:210518252-210518274 AAACAGTGGTTACCATAGAGGGG - Intronic
921492535 1:215795802-215795824 AAGCAGTGGTTCTCAAATTATGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923429909 1:233909938-233909960 AAAAAGTGGTCCAGGAAGAAAGG - Intronic
924151176 1:241131504-241131526 AAACAGTAGTTCTCAAAGTGTGG - Intronic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924268882 1:242311475-242311497 AACCAGTGGTTCTCAAAGTGTGG - Intronic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
924951280 1:248886072-248886094 AAATAATGGTTACCAAAGAAAGG + Intergenic
1063644448 10:7865164-7865186 GAATAGTGGTTCAGAAAGTAGGG + Intronic
1063714151 10:8510742-8510764 AAATAGTGGTTCTCTGAGAATGG + Intergenic
1063982789 10:11469508-11469530 AAACAGTAGTTCCTAAAGAGAGG - Intronic
1064329742 10:14382486-14382508 ACACAGTGTTTCTCAAAGAGTGG + Intronic
1065203197 10:23333535-23333557 AGACAGTGGTTTTCAAAGTATGG + Intronic
1065646958 10:27845172-27845194 AAACAGTGGGTTACACACAAAGG + Intronic
1066223405 10:33357950-33357972 GAGCAGTGGTTCTCAAAGCATGG + Intergenic
1066716030 10:38287290-38287312 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1067509267 10:46881829-46881851 CAGCAGTGGTTCTCAGAGAAGGG - Intergenic
1067652985 10:48170026-48170048 CAGCAGTGGTTCTCAGAGAAGGG + Intronic
1068601916 10:58965682-58965704 AGACAGTGGTTCTCAAAGCATGG + Intergenic
1069031853 10:63604912-63604934 AAACAGTGGTTCTCAACTAGAGG + Intronic
1069314991 10:67087234-67087256 AAACAGAGGTTAACACAGAAGGG + Intronic
1069417414 10:68213185-68213207 ACACAGTGGTTCTCAACAAAGGG - Intergenic
1069431131 10:68335372-68335394 AAACGGTGATTTACACAGAACGG - Intronic
1069888909 10:71640892-71640914 AAACAGTGGTTCTCCAAGTGTGG - Intronic
1069924871 10:71842080-71842102 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1070025693 10:72629429-72629451 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
1070263753 10:74882556-74882578 AAAAAGTCTTTAACAAAGAAAGG - Intronic
1070601039 10:77866395-77866417 AACCAGTGGCTCACAAAGCCTGG - Intronic
1070691192 10:78527543-78527565 ACACAGTGCTTCTCAAAGCATGG - Intergenic
1071709081 10:88031124-88031146 AACCACTTGTTCAAAAAGAAAGG - Intergenic
1072195102 10:93110975-93110997 AAACAGTGGTTGACTAAAAGAGG - Intergenic
1072495914 10:95959248-95959270 AAGCAGTGGGTCTCAAAGTATGG + Intronic
1072508036 10:96089936-96089958 AAAACTTGGTACACAAAGAAGGG + Intergenic
1073831289 10:107386253-107386275 AAATAGTGCTTCTCAAAGTATGG - Intergenic
1074338070 10:112598337-112598359 AAACAATGGTTCAGAAGGAAAGG - Intronic
1074429218 10:113379349-113379371 AGCCAGTGGTTCTCAAAGGAGGG + Intergenic
1075260449 10:120958831-120958853 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1075531917 10:123236887-123236909 GAACAATGGTTCAGAAACAAGGG - Intergenic
1076146143 10:128124493-128124515 GAACAGTGGTTCTCACAGGAGGG - Intronic
1076330652 10:129662694-129662716 ACACAGTGATTCACAAGGGAAGG + Intronic
1076890341 10:133280322-133280344 AAGCAGTGGTTCTCAATGCAGGG + Intronic
1078155374 11:8795372-8795394 AAGCAGTGGTTCTCAAAGTGGGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079375639 11:19889254-19889276 AAAATTTGGTTCACAAACAAAGG - Intronic
1079536293 11:21519441-21519463 AATCAGTGGTTCTCAAACAGTGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079853547 11:25570055-25570077 AAACAGGGGGCCACAAATAAAGG - Intergenic
1080786954 11:35484243-35484265 AAACTGAGATTCACAAAGATTGG + Intronic
1080980853 11:37403773-37403795 AAACATTGATTCAGGAAGAAAGG + Intergenic
1081684253 11:45030456-45030478 AAACAGTGGTTCTCAAAGTGAGG + Intergenic
1082272692 11:50189097-50189119 AAATAGTGGATCAGAAAGATGGG - Intergenic
1082321783 11:50821113-50821135 AAAGAGTGCTTCAAAACGAAAGG - Intergenic
1082575025 11:54792137-54792159 AAACAATGGAATACAAAGAAAGG + Intergenic
1082921304 11:58497658-58497680 AAACATTTGAACACAAAGAATGG + Intergenic
1083225135 11:61280364-61280386 AATGAGTGGTTCTCAAAGTATGG + Intronic
1084104404 11:66971666-66971688 AAACAGTGGTTAAAACAAAAAGG + Intergenic
1084901956 11:72316320-72316342 ACACAGTGGTTCTCAAAGCATGG - Intronic
1085333570 11:75672355-75672377 AAACAGTGGTTCAAACAAGAGGG - Intergenic
1086683797 11:89707055-89707077 AATCAGAGGTTCACAAAGTATGG + Intergenic
1087140372 11:94759906-94759928 AACCAGTGGTTCTCAAAGTGTGG + Intronic
1088767981 11:113003500-113003522 ATATAGTGGTTCACAAAGTCAGG - Intronic
1089291272 11:117439119-117439141 AAACAGAGGTGCACATGGAAGGG - Intronic
1089583587 11:119496428-119496450 CAACAGTGGTTCTCAAAGTGTGG - Intergenic
1089882865 11:121791733-121791755 AATCAGTGGCTCTCAAAGCACGG - Intergenic
1090035380 11:123245457-123245479 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
1090211747 11:124925561-124925583 GAACACAGATTCACAAAGAAAGG + Intronic
1090231280 11:125106739-125106761 AAGCAGTGGTTAACAAATTATGG - Intronic
1091105856 11:132919263-132919285 AGACAGTGGTTCTCAGAGAGGGG + Intronic
1091288473 11:134422757-134422779 AAACAGTGGTGAACAAAACATGG - Intergenic
1092786592 12:12032388-12032410 AAATAGTGGTTCTCAAAGTGTGG + Intergenic
1092974193 12:13728348-13728370 AAACAGTGGTTCTCTAAAACTGG - Intronic
1094059085 12:26294345-26294367 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1094329545 12:29275940-29275962 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1094497226 12:30995894-30995916 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
1095086544 12:38062477-38062499 AAACTGTGGTTAACAGAGACAGG + Intergenic
1095630193 12:44367408-44367430 AAAAAGTGTTTCACAAGGGAAGG - Intronic
1095643714 12:44517147-44517169 AAACATTATTTCACAAATAATGG - Intronic
1095949603 12:47774711-47774733 AAGCACTGGGTCACCAAGAAGGG + Intronic
1096173667 12:49495954-49495976 AAAAAATGGTTAACAAAGAAAGG - Intronic
1097363931 12:58690333-58690355 AAACAATGGATCTGAAAGAAGGG + Intronic
1097717495 12:62982173-62982195 CAGCAGTGGTTCTCAAAGTATGG - Intergenic
1097731388 12:63132105-63132127 AAACAGTGGTTCCCAAACTGTGG - Intergenic
1098304375 12:69087783-69087805 ACCCTGAGGTTCACAAAGAAAGG + Intergenic
1098383789 12:69897386-69897408 ACACAGTGGTTCACAACCAAGGG + Intronic
1098484526 12:71005275-71005297 AAACAGTGGTTAACAGGAAAGGG - Intergenic
1099009612 12:77276442-77276464 ACACAGTGATTCTCAAAGTATGG + Intergenic
1099402954 12:82222462-82222484 TAACAGTCGTTCTCAAAGTATGG + Intergenic
1100049526 12:90429652-90429674 TAACAGTGTTTCAGAAAGAGAGG + Intergenic
1100315088 12:93437810-93437832 AAACAGTGGTTTTCTAAGCAGGG + Intronic
1100515661 12:95325140-95325162 AAACAGTGGTTCCCAGGGATAGG - Intergenic
1100560209 12:95740819-95740841 CATCAGAGGTTCTCAAAGAATGG + Intronic
1102397586 12:112600505-112600527 AAACAGTGGCTCAGAGAGAGAGG - Intronic
1102657167 12:114491802-114491824 AAACTGAGGCTCAGAAAGAAGGG + Intergenic
1102928412 12:116844003-116844025 GAACAGTGGTTCCCAAAGTGTGG + Intronic
1102987494 12:117290389-117290411 AAACAGTCCCCCACAAAGAATGG - Exonic
1103224267 12:119273702-119273724 AAATAGTGTTTCTCAAAGACTGG - Intergenic
1103645290 12:122387211-122387233 ATACAGTGGTTCTCAAAGTGTGG + Intronic
1103702360 12:122854570-122854592 ACACAGTGGTTCTCAAAGTGCGG - Intronic
1104423558 12:128656709-128656731 ACACAGTGGTTCTCAAAGTGTGG - Intronic
1104701640 12:130909161-130909183 AAACAATGGTTTTCAAAGACTGG + Intergenic
1105201413 13:18182796-18182818 GAGCAGTGGTTCCCACAGAATGG + Intergenic
1105301149 13:19135938-19135960 CAACAGTGGTTCTCGAAGAGGGG + Intergenic
1105732991 13:23238049-23238071 AAACAGTGGTTTTCAAATATTGG + Intronic
1106453267 13:29903852-29903874 AAGCAGTGGTTCTGAAAGCATGG - Intergenic
1107395034 13:40006554-40006576 CAACAGTGGTTCCCAAAGAGTGG - Intergenic
1107747943 13:43532358-43532380 TGACAGTGGTTCTCAAAGTATGG + Intronic
1107826730 13:44335334-44335356 GAACAGTGATTCTCAAACAATGG + Intergenic
1108184931 13:47879027-47879049 GATCAGTGGTTCTCAAAGTATGG - Intergenic
1108412349 13:50162508-50162530 ATACACTGGTTCACCAAAAAAGG - Intronic
1108695856 13:52901738-52901760 ATACAGTGGTTCTCAAAGTGTGG + Intergenic
1108772745 13:53724634-53724656 AGACAGTGTTTCACCATGAATGG + Intergenic
1109788284 13:67211961-67211983 AGACAGTGGTTCTCTAAAAATGG - Intronic
1109914764 13:68968323-68968345 AACAAGTAGTTAACAAAGAAGGG - Intergenic
1109967691 13:69723146-69723168 AAACAGTGGTTATCAAAGACTGG + Intronic
1110464379 13:75783996-75784018 AAACAGTGGTTCTCAACCATGGG + Intronic
1110500103 13:76217438-76217460 ACACAGCTGGTCACAAAGAATGG - Intergenic
1110935143 13:81278532-81278554 TAACAATGGGTCACAAACAAGGG + Intergenic
1111409075 13:87850910-87850932 AAATAGTTATTCACACAGAAGGG + Intergenic
1111555323 13:89873751-89873773 AAACAGGTGTAAACAAAGAAAGG - Intergenic
1111824640 13:93252208-93252230 AGACAGTGGTTCTCAAAGTGTGG - Intronic
1111913971 13:94341983-94342005 AAACAGTGTTTCTCAAAGTAGGG + Intronic
1112308082 13:98293443-98293465 AAACACTGGGCCACTAAGAAAGG + Intronic
1112609710 13:100944614-100944636 AGAAAGTGTTTCACAAAGAAGGG + Intergenic
1112807253 13:103176463-103176485 AAAGTGGGGTTCCCAAAGAACGG - Intergenic
1112816182 13:103276317-103276339 ACACAGTGTATCAGAAAGAAGGG + Intergenic
1113089446 13:106602043-106602065 AAACAGTGGTTCACCTAGAAAGG - Intergenic
1113774398 13:112934591-112934613 AACCAGTGGTTCTCAAAGTGGGG - Intronic
1113858265 13:113461849-113461871 AATCAGTGTTTCACAAACTATGG - Intronic
1115397180 14:32921481-32921503 GATCAGTGGTTCTCAAAGAGTGG - Intergenic
1116145683 14:41065277-41065299 AATCAGTTGTTAGCAAAGAAAGG + Intergenic
1116481875 14:45400816-45400838 AATCAGTGGTTCCCAAACCAGGG - Intergenic
1116558678 14:46347543-46347565 GTACAGATGTTCACAAAGAAAGG + Intergenic
1116588652 14:46742602-46742624 GAACAGTGGTTCTCAAAGTGTGG - Intergenic
1117268538 14:54116579-54116601 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1117328364 14:54689275-54689297 AGGCACTGGTTCACAAAGTATGG - Intronic
1117331774 14:54719525-54719547 AAACAGTGTGTCACAAAGAAGGG - Intronic
1117802274 14:59456980-59457002 AAACAGTGGTTGCCTGAGAAAGG + Intronic
1117803408 14:59466417-59466439 AAGCAGTGGTTCACAGAGTATGG + Intronic
1118221756 14:63860919-63860941 GAGCAGTGGTTCTCAAAGTAGGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118540330 14:66815932-66815954 ATACACTGGTTCAAAAAAAAGGG + Intronic
1118891544 14:69914017-69914039 AACCAGTGGTTCTCAAAGTATGG + Intronic
1118909483 14:70049322-70049344 AGACAGTGGAGCAGAAAGAAAGG + Intronic
1120040161 14:79743612-79743634 AAAAAGTGTTTCTCAAAGTATGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120222591 14:81751349-81751371 AAACAGTTGTTCACAAACTGTGG + Intergenic
1120675891 14:87420843-87420865 AAACAATGGTTACCAAAGACTGG + Intergenic
1123166743 14:106332582-106332604 AAGCAGTTCTTCAAAAAGAATGG + Intergenic
1123169426 14:106357629-106357651 AAGCAGTTCTTCAAAAAGAATGG + Intergenic
1124464479 15:29924636-29924658 AGACAGTGGCTCTCAAGGAAAGG - Intronic
1124478204 15:30054625-30054647 AATGACTGTTTCACAAAGAATGG + Intergenic
1124553743 15:30707253-30707275 GAACAGTGGTTCTCAAAGTGAGG - Intronic
1124677505 15:31698421-31698443 GAACAGTGGTTCTCAAAGTGAGG + Intronic
1125090371 15:35783885-35783907 AAACAGTGTTTCTCAAAGTATGG - Intergenic
1125191769 15:37001922-37001944 AATAAGTGTTTCACAAAGTACGG - Intronic
1125313280 15:38403430-38403452 GAGCAGTGGTTCTCAAAGTATGG + Intergenic
1125998653 15:44188627-44188649 AAGCAGTGGTTCTCAAAGTATGG - Intronic
1126274135 15:46856365-46856387 AAACAGTGTTTGACATATAATGG - Intergenic
1126391063 15:48152895-48152917 AAACAGTAATTCACAAAGTATGG + Intronic
1126442585 15:48706560-48706582 AAACAGTGGTTACCAGAGACTGG - Intergenic
1126866392 15:52941703-52941725 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1127005632 15:54566269-54566291 ATACTGTGTTTCTCAAAGAAAGG + Intronic
1127544242 15:59975537-59975559 ACAAAGTGGTTCTCAAAGAAGGG + Intergenic
1127643221 15:60934704-60934726 ATACAGTGGTTCTCAAAGTGTGG - Intronic
1127644108 15:60943164-60943186 AACTAGTGGTTTAGAAAGAAAGG + Intronic
1127686523 15:61350950-61350972 GAACAGTGGTTCTCAAACTATGG - Intergenic
1128729683 15:70012878-70012900 AACGGGAGGTTCACAAAGAAAGG - Intergenic
1128832476 15:70782026-70782048 AAACAGTGGTCTACAAAATAGGG + Intergenic
1129135947 15:73551368-73551390 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1129153989 15:73706322-73706344 AAACTGAGGTCCACAGAGAAGGG + Intronic
1129500787 15:76035751-76035773 AAACAGTTGTTAACAAACATGGG - Intronic
1130657674 15:85803340-85803362 GAACAATGGTTAACAAACAACGG + Intergenic
1130665269 15:85864138-85864160 AAACAATGGTTCTCAAAGCATGG + Intergenic
1130774415 15:86963748-86963770 GAACAGTGGTTCAATGAGAAAGG - Intronic
1130905451 15:88237346-88237368 AAACAATGGGTCACAAAATAGGG - Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132006603 15:98233163-98233185 AAGCAGTGGTTCTCAAAGTATGG + Intergenic
1132007950 15:98247885-98247907 AAACAAAGCTTCATAAAGAAAGG - Intergenic
1134213886 16:12300939-12300961 AACCAGTGGTCCTCAAAGGAGGG - Intronic
1134876974 16:17709312-17709334 GAACAGTGGCTCTCAAAGTATGG + Intergenic
1134908209 16:18000276-18000298 AAACAATGGTTCTCAAAGTGTGG + Intergenic
1135046321 16:19158937-19158959 GACCAGTGGTTCTCAAAGCATGG - Intronic
1135676828 16:24422542-24422564 AAAAAGTGATTTAAAAAGAATGG - Intergenic
1135948303 16:26885901-26885923 AATCAATTGTTCACTAAGAATGG + Intergenic
1135984933 16:27177124-27177146 AATCAGTGTTTCTCAAAGCATGG + Intergenic
1136291303 16:29273211-29273233 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1136510566 16:30736023-30736045 ACTCAGTGGTCCACAAAGGATGG - Intronic
1137369334 16:47890297-47890319 GGACAGTGGTTCAGAATGAAAGG + Intergenic
1138064941 16:53931020-53931042 AAAGAAAGTTTCACAAAGAAAGG - Intronic
1138237331 16:55395723-55395745 GAACAGTGGTTCTCAAAGTATGG + Intronic
1138314838 16:56061030-56061052 AAATTGAGGTTCAAAAAGAAAGG + Intergenic
1138699115 16:58845082-58845104 GACCAGTGGTTCATAAACAAGGG - Intergenic
1138911174 16:61401054-61401076 AAACAGTGGTTCTCAAAGTGCGG + Intergenic
1139044074 16:63035032-63035054 ATAGAATGGTTTACAAAGAAAGG + Intergenic
1139354359 16:66358538-66358560 AGACAGTGGTTCTCAAAGTGTGG - Intergenic
1139807696 16:69583069-69583091 AAACAATGATTAAAAAAGAATGG - Intronic
1139818837 16:69702521-69702543 AACCAGTGGTTCTCAGAGTATGG + Intronic
1139834983 16:69830943-69830965 AAACACTGGTACACAGAGGAAGG - Intronic
1140643660 16:77006209-77006231 AAACAGTTATTCACAGAGCAAGG - Intergenic
1143225327 17:5297190-5297212 AACCAGTGGTTCTCAACTAAAGG - Intronic
1143834630 17:9680716-9680738 AAATAGTGGTTCTCAAAGTGTGG - Intronic
1144040691 17:11408273-11408295 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144814536 17:18024840-18024862 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1146012685 17:29208295-29208317 TATCAGTGGTTCTCAAATAAGGG - Intergenic
1146392343 17:32434214-32434236 GAGCAGTGGTTCTCAAAGTATGG - Intergenic
1148037754 17:44680912-44680934 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1148489880 17:48016205-48016227 AAACAGTTGTTTACAAAGGCTGG - Intergenic
1148949710 17:51300193-51300215 GATCAGTGGTCCACAAAGCAGGG + Intergenic
1148986532 17:51627411-51627433 AGCCAGTGGTTCTCAAAGCATGG - Intergenic
1149123791 17:53203378-53203400 AAAAAGTGGCTAACAAAGTATGG + Intergenic
1149281934 17:55114957-55114979 AAAAACTTGCTCACAAAGAAAGG - Intronic
1149867489 17:60158768-60158790 AAACAGTGGTTCTCAAAGTGCGG + Intronic
1150337320 17:64340176-64340198 AAACAGTGCTTCTCAAATATTGG + Intronic
1150978482 17:70115687-70115709 AAACAGTGGGTAACAAATCAGGG - Intronic
1151011610 17:70504473-70504495 AACCAGTGGTTCTCAAAGTGTGG + Intergenic
1151146104 17:72042926-72042948 GAACAGTGGTTCCCAAACAGGGG - Intergenic
1151638666 17:75372320-75372342 AAATAAAGGTTCACAAGGAAAGG + Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1153284092 18:3441605-3441627 GAATAGTGGTTCTCAAAGCAGGG - Intronic
1153304683 18:3620928-3620950 AAACAGTGGTTCCCAGAGGTTGG + Intronic
1153383240 18:4461607-4461629 AAACAGTGGTACAAAAACCAAGG + Intergenic
1153947522 18:10030846-10030868 GAACAGTGGTTCTCAAAGTGGGG - Intergenic
1154413478 18:14157575-14157597 AAACAGTCCTTCCCAAACAAGGG + Intergenic
1155374162 18:25137879-25137901 AAACAGTGCTGCATAAAGAACGG - Intronic
1155518487 18:26645755-26645777 AAACAGAGGTTCTCAAAGTGCGG + Intronic
1156028842 18:32689397-32689419 AAATAGTGTTTCAAAAGGAAGGG + Intronic
1156834666 18:41538098-41538120 AAATAGTGGTTCTCAAATATTGG - Intergenic
1157035656 18:43969867-43969889 AAACAGTATTTCACAAAAAGCGG + Intergenic
1157143608 18:45137997-45138019 AAAATGTGGTTCAGAGAGAATGG + Intergenic
1157315985 18:46590112-46590134 ACACAGTGGTTCTCAAAGTGTGG + Intronic
1157849767 18:51037262-51037284 AAACAGTGGTTCCCAAAGTATGG + Intronic
1158072159 18:53484966-53484988 AAACAGTGGTTCCCACAGGTGGG + Intronic
1158374082 18:56843388-56843410 GAACAGTGGTTGACAGAGGATGG - Intronic
1158509478 18:58077813-58077835 AAACAGTGGTTCTCAACCAGGGG + Intronic
1158518752 18:58152750-58152772 GAAGAGTGGTTCTCAAAGTACGG - Intronic
1158842746 18:61405666-61405688 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1158902007 18:61972768-61972790 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160296030 18:77637724-77637746 AAGCAGTGGTTCTCCAAGCATGG + Intergenic
1161304977 19:3562283-3562305 AAACTGAGTTTCACAAAGACGGG + Intronic
1161688478 19:5716467-5716489 AAACACTGGCTCTCAAAGGATGG - Intronic
1162221950 19:9185000-9185022 AAACAGTGGTTACCAGAGGAGGG + Intergenic
1164225100 19:23237997-23238019 AAAAAGTGGAGCACAAAGATAGG - Intronic
1166441484 19:42819170-42819192 AAACACTGGGAGACAAAGAAGGG + Intronic
1166592411 19:44011746-44011768 AAACAGTGGTTCTAGAAGCAGGG - Exonic
1168052959 19:53843407-53843429 GAACAGTGGTTCTCAACGGAGGG - Intergenic
1168521453 19:57054057-57054079 AACCAGTGGTTCTCAAACAGGGG - Intergenic
925721461 2:6832478-6832500 AATCAGTGGTACACATAAAAAGG - Intergenic
925774528 2:7321263-7321285 AAGCAGTGGTTCTCAAAGAGAGG - Intergenic
926074705 2:9932675-9932697 AAGCAGTGGTTCTCACAGCATGG - Intronic
926370105 2:12170834-12170856 GCACAGTGGTACACAAAGGAGGG + Intergenic
926888034 2:17615583-17615605 AAACAGTGGTTTAAATAGACAGG + Intronic
927010376 2:18897839-18897861 AAGCAGTGCTTCACAACCAAAGG + Intergenic
927014086 2:18938446-18938468 AAACAGTGTCTCAAAAAGAGAGG + Intergenic
927097943 2:19762443-19762465 TAACAGGGGTCCACATAGAAAGG + Intergenic
927310205 2:21622033-21622055 AAACAGTGGTTACCAAAATAAGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928726398 2:34178871-34178893 TAACAGTGGTTCTCAAAGCATGG - Intergenic
928946453 2:36776209-36776231 AACCAGTGGTTCTCAAAGTGTGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929263382 2:39891832-39891854 AAACAGTGGTTCCCAACTAGGGG - Intergenic
929437005 2:41936524-41936546 AAACCGTGGTGCAAAAAGAAAGG + Exonic
929866572 2:45722489-45722511 AAGCAGTGGTTCCCAAAGTGTGG - Intronic
930114947 2:47710525-47710547 GAGCAGTGGTTCCCAAAGGAGGG + Intronic
930773295 2:55149341-55149363 TACCAGTGGTTCCCAAAGAGTGG + Intergenic
930795888 2:55390351-55390373 AAGCAGTGGTTCTCAGAGTATGG - Intronic
930864857 2:56112335-56112357 AAACAGTGGTTCTTAAAGCCTGG + Intergenic
930922977 2:56779835-56779857 GAACAGTGGTTCTCAGAGGATGG + Intergenic
931580770 2:63770618-63770640 ATACAGTGGTTCTCAAAGTGTGG + Intronic
932488861 2:72105606-72105628 AAACAGTGGTTCACAACTTTGGG + Intergenic
932688183 2:73891329-73891351 ACACAGAGGTTCCCAAAGCATGG - Intergenic
932806742 2:74791091-74791113 AAACAGGGGTGCACAAACCATGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933825475 2:86156262-86156284 AAACAGTGGTTCTCAACTGAGGG - Intronic
935971857 2:108537273-108537295 TAACAGTGGTTCTTAAAGTATGG - Intronic
936239238 2:110772717-110772739 AACCAGTGGTTCTCAAAGTAAGG + Intronic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937371870 2:121303936-121303958 ATACAGTGGTAGAGAAAGAATGG - Intergenic
937774468 2:125759513-125759535 AAACAGTGGCACACAAAGCAAGG - Intergenic
937962783 2:127474204-127474226 ACACACAGGTTGACAAAGAAAGG + Intronic
938134950 2:128749196-128749218 AAACAGTGGATCCCAAATAAGGG + Intergenic
938242680 2:129755515-129755537 AAACAGTGGTTCTCAAAGTGTGG + Intergenic
938636131 2:133228257-133228279 AAAAAGTGCTTTTCAAAGAAAGG - Intronic
938659770 2:133473560-133473582 GAACAGTGGTTTTCAAAGTATGG - Intronic
939149672 2:138457897-138457919 AAACTGAGGTTCATAAAGGAAGG + Intergenic
939503314 2:143012869-143012891 AAAGAGTGGTTACCAAAGACAGG - Intronic
939806793 2:146783879-146783901 AAACAGTGGGTCAGAAAGAGTGG - Intergenic
940361435 2:152800251-152800273 AAACAGTTGTTGGTAAAGAAAGG + Intergenic
940556777 2:155238810-155238832 AAACTGTGTTTCAAAATGAATGG + Intergenic
940585065 2:155637315-155637337 AAAGAGTGGTTCACACTAAAAGG - Intergenic
941094061 2:161215186-161215208 AACCAGTGGTTCTCAAAATATGG - Intronic
941432189 2:165426479-165426501 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
942394902 2:175536767-175536789 AGGCAGTGGTTCACAAAGTGTGG - Intergenic
943000817 2:182326545-182326567 GAACAGTTGTTCTCAGAGAATGG + Intronic
943389941 2:187252697-187252719 AAGCAGTGGTTTTCAAAGTAAGG - Intergenic
943595857 2:189855173-189855195 AAACAGTGAGTCATATAGAATGG - Intronic
943619101 2:190127805-190127827 AAACAGTGTTTCCCAAAGCATGG + Intronic
943666699 2:190616550-190616572 AAACAGTGGCTTACACAGCATGG + Intergenic
943765006 2:191651200-191651222 AAAAAGAGGATCAGAAAGAAAGG + Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
943931064 2:193854049-193854071 AATCAGAGGTTCTCAAAGAAAGG + Intergenic
944437743 2:199708890-199708912 AATCAGAGTTTCAGAAAGAAAGG - Intergenic
945031159 2:205664917-205664939 AAACACAGGTACACAAAGAAGGG - Intergenic
945171308 2:206998916-206998938 GAAAAGTGGTTCTCAAAGCATGG + Intergenic
945577630 2:211552004-211552026 AAAACGTGGTTCACAATGATTGG - Intronic
945739972 2:213647483-213647505 ATACAGTGATTCACAGAGTAGGG + Intronic
945794244 2:214342220-214342242 AAGCAGGGGTTCCCAAAGCAGGG + Intronic
945913877 2:215682096-215682118 AAACAGTAGTTCTCAAGAAATGG - Intergenic
946556612 2:220865596-220865618 AAATACTGGTTGTCAAAGAATGG + Intergenic
946597842 2:221326253-221326275 AAACAGTGGTTAGCAAACTATGG - Intergenic
946876942 2:224138884-224138906 AAACAGTGGTTAGCAAGGATAGG - Intergenic
947268967 2:228312301-228312323 GAACAGTGGTTCTCGAAGTATGG + Intergenic
947283319 2:228480977-228480999 GAACAGTGGTTCCCAAAGTGTGG + Intergenic
947328826 2:229006815-229006837 TAACAGTGGTTCTCAAAGTGTGG - Intronic
947494032 2:230619884-230619906 AAGCAGTGGTTCTCACAGCATGG + Intergenic
948471023 2:238179250-238179272 ACACAGTGATTCACAAAGGAAGG + Intronic
948583888 2:239006406-239006428 GAACAGTGGTTCCCAGAGGATGG - Intergenic
1169294163 20:4378345-4378367 AAGCAGTGGTTCCCAAAGTGTGG - Intergenic
1169547072 20:6661172-6661194 GAACAGTGGTTCTCAAACTATGG - Intergenic
1169693160 20:8356449-8356471 AATCAGTGGTTTTCAAAGTATGG - Intronic
1169743829 20:8922840-8922862 TAACAGTGGTTCTCAAAGTTTGG - Intronic
1169839203 20:9915987-9916009 CAGCAGTGGTTCACAAAGTGTGG + Intergenic
1170142082 20:13134517-13134539 CAGCAGTGGTTCTCAAAGAGTGG + Intronic
1170309292 20:14975194-14975216 AATCAGTGGTTCTCAACTAAGGG - Intronic
1170412066 20:16102797-16102819 AGCCAGTGGTTCACAAAGGGTGG - Intergenic
1170439173 20:16360733-16360755 CTACAGTGTTTCACCAAGAATGG - Intronic
1171331049 20:24339166-24339188 AAACAGAGGCTGAGAAAGAAAGG - Intergenic
1171994432 20:31721291-31721313 ATACAATGGTTCACACACAAAGG - Intronic
1173012156 20:39192090-39192112 AACCAGTGGTTCACAAAGTGTGG - Intergenic
1173213935 20:41061734-41061756 ATACAGTTGTTCACTAAGATAGG + Intronic
1173299715 20:41791244-41791266 AAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1173300713 20:41799953-41799975 AAACAGTGATTCTCTAAGTATGG - Intergenic
1173343253 20:42174007-42174029 AAATATTGGTTGGCAAAGAATGG + Intronic
1174200987 20:48806200-48806222 GAACAGTGGTTCTCAAACAAGGG - Intronic
1174496941 20:50952503-50952525 AAACACTGGGTTAAAAAGAAAGG + Intronic
1175277857 20:57784006-57784028 AAACAGTGGCTCAGAGAGAGTGG + Intergenic
1175502044 20:59457357-59457379 AAACTGAGGTTCAGAAAGAGTGG + Intergenic
1176716536 21:10355192-10355214 GAACAGTGGTTCCCACAGAATGG - Intergenic
1176859543 21:14000671-14000693 AAACAGTTCTTCCCAAACAAGGG - Intergenic
1178211340 21:30536733-30536755 AAACAAGAGTTCAGAAAGAAGGG - Intergenic
1178960762 21:37062586-37062608 AACCAGTGGTTCTCAAAGTCCGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180601802 22:17024744-17024766 GAGCAGTGGTTCCCACAGAATGG + Intergenic
1181856789 22:25787432-25787454 CAACAGTGGTTCTCAAAGCGGGG - Intronic
1182170016 22:28219061-28219083 CATCAGTGGTTCTCAAAGTATGG - Intronic
1184077448 22:42191266-42191288 AAACTGTGTTTCAGAAAAAAAGG - Intronic
1184304413 22:43586720-43586742 AAACAGTGGTTCTCAAGGTGGGG + Intronic
1184369244 22:44072157-44072179 AAACAATGGCTCACACAGCAAGG - Intronic
1184369559 22:44074032-44074054 GAACAGAGGATCCCAAAGAAGGG - Intronic
949265505 3:2152335-2152357 TGACAGTGGTTTACAAAGACTGG - Intronic
949388276 3:3530078-3530100 TAACAGTGGTTCTCAAAGCGTGG + Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
949790756 3:7789569-7789591 GAACAGTGGTTCTCAAAGCGTGG - Intergenic
950184325 3:10935893-10935915 GAACAGGGGTTAACAATGAATGG - Intronic
950893041 3:16422089-16422111 AAACAGTGGTTACCAAAGTGGGG - Intronic
951244280 3:20322572-20322594 GAGCAGTGGTTCTCAAAGTATGG - Intergenic
951578249 3:24135113-24135135 ACTCAGTGGTTCTCAAAGAGTGG - Intronic
952164130 3:30727882-30727904 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
952533530 3:34287109-34287131 CAACAGTGGACCACATAGAAGGG + Intergenic
952766013 3:36955074-36955096 GAACAGTGGTTCTCAACCAAGGG + Intergenic
953180981 3:40595249-40595271 AATCTGTGCTTCTCAAAGAATGG + Intergenic
953370150 3:42380668-42380690 GATCAGTGGTTCACAAAATATGG - Intergenic
953797101 3:45994532-45994554 GAACAGTGGTTGTCACAGAAGGG + Intronic
953934807 3:47032181-47032203 AGACAGTGGTTCTCAAAGTTTGG - Intronic
954904884 3:54052581-54052603 AACCAGAGTTTCTCAAAGAATGG - Intergenic
955059520 3:55483540-55483562 AAACTGAGTTTCCCAAAGAAGGG + Intronic
955094068 3:55779934-55779956 AATCAGTGGTTCTCAAACTAAGG - Intronic
955571271 3:60309381-60309403 AACCAGTGGTCCAAAAAGTATGG + Intronic
955577987 3:60387345-60387367 AAACAGAGGTGAACAAAGCATGG - Intronic
955648413 3:61165863-61165885 GAAAATTGGTTGACAAAGAATGG + Intronic
955725564 3:61928866-61928888 ATACAGTGGTTCTCAACTAAAGG + Intronic
956270104 3:67442346-67442368 GAACAGTGGTTCTCAAACTATGG + Intronic
956933059 3:74068052-74068074 GAACAGTGGTTCTCAAAGTGTGG + Intergenic
959554277 3:107698907-107698929 AAACAGAGGGTCACAGAGCAGGG + Intronic
960113886 3:113873384-113873406 ATACAGTGGTTCTCAAAGTGTGG + Intronic
960891296 3:122451187-122451209 AAACAGTGGTTCTCAAAGTGTGG - Intronic
961429689 3:126872542-126872564 AAACAGTGTTTCTCAAAGGTGGG - Intronic
961953708 3:130777802-130777824 AAACAGTGGTTTACCAAAGATGG + Intergenic
962032423 3:131615147-131615169 AGACAGTGGTTCTCAAACCATGG - Intronic
962281020 3:134051967-134051989 AAACAGAGGTTCTGAAAGCATGG - Intronic
962355355 3:134689394-134689416 AAACAGAGCTTCACAAACTATGG + Intronic
962425031 3:135262161-135262183 ATACAGTGGTTCTCAAAGCATGG - Intergenic
962527451 3:136249590-136249612 AATCAGTAGTTCTCAAAGTATGG - Intergenic
962983247 3:140509456-140509478 GAACAGTGGTTCTCAAAGTGTGG - Intronic
963153562 3:142072446-142072468 AAACAGTGATTCAAAAAGAAAGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964127436 3:153250068-153250090 AAGCAGTGTTTCCCAAAGCATGG + Intergenic
964665194 3:159164318-159164340 AATCAGATGTTCACAAAGTAGGG + Intronic
965792600 3:172405616-172405638 TAACAGTGTTTCCCAAAGTAAGG + Intergenic
966394391 3:179487198-179487220 TACCAGTGTTTAACAAAGAAAGG + Intergenic
966640171 3:182180880-182180902 AAACAGTAGTTGATAAAGACAGG + Intergenic
966648609 3:182274083-182274105 AATCAGTGGTTCTCAAAGTGTGG - Intergenic
967237434 3:187399560-187399582 AAAAAGTGGTTGAGAAATAAAGG + Intergenic
967427690 3:189346257-189346279 ACACCGTGGTTCTCAAAGGAAGG + Intergenic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
967661161 3:192112238-192112260 AAACTGTGATTAACAGAGAATGG + Intergenic
967661162 3:192112396-192112418 AAACTGTGATTAACAAAGAATGG - Intergenic
967776793 3:193393767-193393789 AAACAGATGTTCACAGACAAAGG + Intergenic
967785299 3:193487163-193487185 AAAGAGTGCTTCAGAAAGAATGG + Intronic
968217075 3:196901873-196901895 AGGCAGTGGTTCTCAAAGCATGG + Intronic
968224581 3:196965758-196965780 ACACACTGGTTAACAAAGGAGGG - Intronic
969183298 4:5458031-5458053 AAGCAGTGGTTCCCAAGGTATGG + Intronic
969229705 4:5821493-5821515 AACCTGTGGTTCACTAGGAAGGG + Exonic
969268416 4:6081347-6081369 AAACAGAGGCTCAGAGAGAATGG + Intronic
969948683 4:10811335-10811357 AAGCAGTGATTCTCAAAGCAGGG - Intergenic
970135811 4:12922375-12922397 AAACAGTGAGTGACAAAGTAAGG - Intergenic
971434170 4:26602224-26602246 ATGCAGTGGTTCTCAAAGTATGG + Intronic
971519052 4:27526314-27526336 AAACACTTGTTCAGGAAGAAAGG + Intergenic
972170801 4:36343103-36343125 AAACAGTGCTACTCAAAGCATGG + Intronic
972308063 4:37851321-37851343 AAACAGTGGTTCTCAAAGTGAGG - Intronic
972843926 4:42964839-42964861 AGACATTCTTTCACAAAGAAGGG + Intronic
973615973 4:52678211-52678233 AGACAGTGTTTCTCAAAGTATGG - Intergenic
973845609 4:54909882-54909904 GCCCAGTGGTTCTCAAAGAATGG - Intergenic
974553907 4:63418479-63418501 AAATAGTGGTTCCCTAGGAAGGG + Intergenic
975068898 4:70106872-70106894 AAATAGTGGTTACCAAAGGATGG - Intergenic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977498067 4:97802117-97802139 AAACAGTGTTTCTCAAAGTGTGG - Intronic
977911389 4:102541222-102541244 CATCAGTGGTTCTCAAAGAGGGG - Intronic
978200474 4:106019147-106019169 GAACAGTGGTTCTCAAAATATGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978476166 4:109133501-109133523 ATTCAGTTGTTCACCAAGAAAGG + Intronic
978490259 4:109303981-109304003 ACACAGTGGTTCTCAAAGGATGG + Intergenic
978606829 4:110489824-110489846 AAATAGTGGATCAGAAAGATGGG - Intronic
978855082 4:113385720-113385742 AAACAGGGATCCACAATGAACGG - Intergenic
979651656 4:123140238-123140260 TAAGAGTGGTTGACAAAGGATGG - Intronic
980460545 4:133105643-133105665 TAGCAGTGGTTCTCAAAGTATGG + Intergenic
980841900 4:138272904-138272926 AAACAGAGGTTCAGAAGCAAAGG - Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983107506 4:163707408-163707430 AAACAGAAATTCACAAAAAAAGG + Intronic
983502942 4:168520488-168520510 AAACAGCGGTTAAGAAAGAATGG - Intronic
983544293 4:168946320-168946342 TAACAATGGTTCTCAAAGTATGG + Intronic
983627855 4:169820202-169820224 CAGCAGTGTTTCTCAAAGAATGG - Intergenic
984958338 4:185068761-185068783 AATCAGTGGTTCTCAAAGTACGG - Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986886151 5:12238973-12238995 CATCAGTGGTTCCTAAAGAAAGG + Intergenic
987087237 5:14482287-14482309 GAACAGTGGTTCTCAAAGTGTGG - Intronic
987267385 5:16270984-16271006 AAACAGTGCTGCACAAACATGGG - Intergenic
987898673 5:23982062-23982084 TAATAGTGCTTCTCAAAGAAAGG + Intronic
987908274 5:24107006-24107028 ATACACTGGTTCATACAGAATGG - Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988272124 5:29031096-29031118 AAACCCTGGTCCCCAAAGAAGGG + Intergenic
989145361 5:38244218-38244240 AAGCAGTGGTTCTCAAAGTATGG - Intergenic
989679252 5:44009744-44009766 AAACAGTGGTTAACAGAGGCTGG - Intergenic
990121689 5:52462280-52462302 ATACAGTGGTACACAAGTAAAGG - Intergenic
990931966 5:61102084-61102106 AATCAGTGGTTCACAAAATATGG - Intronic
991068554 5:62451583-62451605 AAACAGTGGTTCTCAAAGTGTGG - Intronic
991595742 5:68303553-68303575 AACCAGTGGTTCCCAAAGTGTGG + Intergenic
992283712 5:75210089-75210111 AAACAATGATTCTCAAAGTATGG - Intronic
992524702 5:77597215-77597237 GAGCAGTGGTTCTCAAAGAGTGG - Intronic
993089194 5:83402921-83402943 AGACTGTGGTCCCCAAAGAAAGG + Intergenic
993168634 5:84386993-84387015 AATTAGTGGTTCAAAAAGAGGGG - Intergenic
993223273 5:85131701-85131723 CAACAGTGGTTCACAAGGTGGGG + Intergenic
993580927 5:89660461-89660483 AAACAGTGGAGCACAAAAATTGG + Intergenic
993846840 5:92954493-92954515 AAACAGTGTTTTATAAAGATTGG + Intergenic
995385994 5:111589596-111589618 AAACAGTGATTCTCAAAGTATGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
995938560 5:117549356-117549378 AAACTTTGTTTCAAAAAGAATGG + Intergenic
996361544 5:122653225-122653247 AGACAGTGGTACTGAAAGAAAGG + Intergenic
996588583 5:125119671-125119693 ATACAGTGGTTCCCAAAGCATGG - Intergenic
998608716 5:143664455-143664477 AGACAGTTGTACATAAAGAAAGG - Intergenic
998867138 5:146516664-146516686 AAACAGTGGTTCTCAAAGTGTGG - Intergenic
999635894 5:153622052-153622074 GATCAGTGGTTCTCAAGGAATGG + Intronic
999895721 5:156031277-156031299 CATCAGTGGTTCTCAAAGAGTGG - Intronic
1000007059 5:157195950-157195972 TAACAGTGGTTCTCAACCAAAGG + Intronic
1000736116 5:164902808-164902830 AAATATTGGTTCTCAAATAATGG + Intergenic
1000744837 5:165019792-165019814 AAACAGTTGTTCTCAAAGTGTGG - Intergenic
1000930129 5:167241601-167241623 GAAGGGTGCTTCACAAAGAAAGG + Intergenic
1000931758 5:167261030-167261052 GGACAGTGGTTCTCAAAGTATGG + Intergenic
1001083311 5:168682543-168682565 AACCAGTGGTTCTCAAAGCGTGG - Intronic
1001843163 5:174897819-174897841 AAACAGTGATTCTTGAAGAAAGG - Intergenic
1002938712 6:1697561-1697583 AACCAATGGTTCTCAAAGTATGG + Intronic
1003034717 6:2632775-2632797 AAAAGATGGATCACAAAGAATGG - Intronic
1003124186 6:3342495-3342517 AAACAGTGCTTCTCAAAGGTGGG + Intronic
1003144087 6:3495147-3495169 AGCCAGTGGTTCTCAAAGAGTGG + Intergenic
1003830147 6:10000520-10000542 GTACAGTGGTTCTCAAAGTATGG + Intronic
1003884758 6:10511705-10511727 GAACAGTGGTTACCAGAGAATGG + Intronic
1004200171 6:13541100-13541122 AGACAGTGGTTCTCAAAGTGTGG + Intergenic
1005142581 6:22650367-22650389 TACCAGTGGTTCTCAAAGCACGG - Intergenic
1005917599 6:30367005-30367027 AAATAGTGATTCACATAAAATGG + Intergenic
1006970032 6:38033480-38033502 AGACAGGGGTTCACAAGGAATGG + Intronic
1007270561 6:40633277-40633299 ATGCAGTGGTTCTCAAAGCATGG + Intergenic
1008458333 6:51738311-51738333 AAACTGTGGTTAACAGAGACAGG + Intronic
1008462575 6:51792718-51792740 GAGCAGTGGTTCTCAAAGTATGG + Intronic
1008621613 6:53276785-53276807 CAGCAGTGGTTCTCAAAGTATGG - Intronic
1009196905 6:60697260-60697282 TCACAGTGGTCCACCAAGAAAGG + Intergenic
1009262647 6:61514172-61514194 AAACAGTGGAATAAAAAGAAAGG - Intergenic
1009862924 6:69358167-69358189 AACCAGTGGTTGTCAAAGAGTGG + Intronic
1010665432 6:78624268-78624290 AAAGAGAGGTTCCCAAAGAAGGG + Intergenic
1010792854 6:80084773-80084795 GAACACTGGTTCTCAAAGAGGGG - Intergenic
1011452182 6:87505105-87505127 GACCAGTGGTTCTCAAAGTATGG - Intronic
1011507293 6:88059778-88059800 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1011547157 6:88493921-88493943 AACCAGTGGTTCTCAACCAAGGG + Intergenic
1012083506 6:94792097-94792119 AAACAATAGTTCAAAAAGTAAGG + Intergenic
1012200831 6:96404204-96404226 AAACAGTAATTCACAATGGATGG - Intergenic
1012242576 6:96890614-96890636 TAACAGTAGTTCCCAAATAAAGG - Exonic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013989762 6:116239930-116239952 AAACTGTGGTATAAAAAGAATGG + Intronic
1015115681 6:129646893-129646915 AAACAGTGGTTTTCAAAGCGTGG - Intronic
1015876481 6:137827939-137827961 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017321824 6:153103231-153103253 AAACAGTGGTTAAGGAATAATGG + Intronic
1017379023 6:153805855-153805877 AACCAGTGGTTCACAATGCTTGG + Intergenic
1017405669 6:154115905-154115927 AAACAGGAGCTCCCAAAGAAGGG - Intronic
1017930742 6:158952567-158952589 AAACAGTGATCCACAAATATTGG - Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019846872 7:3511764-3511786 AAACAGTGGCTGCCTAAGAATGG - Intronic
1020678001 7:11203104-11203126 AAACTGGGGGTCACAAAGAATGG - Intergenic
1020818759 7:12939601-12939623 GACCAGTGGTTCTCAAAGCACGG - Intergenic
1020990392 7:15188125-15188147 AAACAGAGGTTCACGAAGAAGGG + Intergenic
1021271700 7:18595844-18595866 CAACAGTGGGACACAAAGTATGG - Intronic
1021422872 7:20465042-20465064 AAAAAGTGTTTCAAAAAGCAGGG - Intergenic
1021497996 7:21297560-21297582 CCACAGTGGTTCACAAAATATGG - Intergenic
1021526642 7:21595476-21595498 AAACAGAGTTTCCCAAAGACTGG + Intronic
1021889174 7:25170916-25170938 TAACAATGGTTCTCAAAGAGTGG + Intronic
1021893279 7:25208750-25208772 AAACAGTGGTTAACAGAGATGGG - Intergenic
1022050766 7:26668137-26668159 AAACAGTTTTACACAAATAATGG + Exonic
1022334129 7:29406634-29406656 GATCAGTGGTTCTCAAAGCATGG + Intronic
1022834698 7:34102508-34102530 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1022970762 7:35514622-35514644 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1024838969 7:53561290-53561312 AAGCAGTGGTTCTCAAAGTCTGG + Intergenic
1025254916 7:57377872-57377894 AAATAGTGGTTCTCAACCAAGGG - Intergenic
1025624721 7:63210469-63210491 AAATAGTGGATCAGAAAGATGGG - Intergenic
1026036194 7:66832214-66832236 GAACACTGGTTCACAATGCAGGG + Intergenic
1026146708 7:67752768-67752790 AAACAGTAGTTCTCAAAGTGTGG - Intergenic
1026326817 7:69317719-69317741 AAACAGTGATTCTCAAAGTAGGG + Intergenic
1026448960 7:70510454-70510476 ACACAGTGGTTCTCAAAGAGTGG + Intronic
1026582940 7:71633164-71633186 TAAATGTGGTTCACAGAGAATGG + Intronic
1026628276 7:72015797-72015819 TAACAGTGGTTCTCAAAGTGTGG - Intronic
1027469001 7:78550279-78550301 AAACTGAGGTGCCCAAAGAATGG - Intronic
1027525582 7:79265140-79265162 AACCAGTGGTTCTCAAAGTTTGG + Intronic
1027590671 7:80115121-80115143 AAACAATGCTTAACACAGAAAGG + Intergenic
1028074608 7:86496516-86496538 AAAAAGCGTTTCACAAAAAATGG + Intergenic
1028213355 7:88101966-88101988 CACCAGTGGTTCTCAAAGAGTGG - Intronic
1028714755 7:93952520-93952542 AAGCAGTGGTTCTCAAAGCATGG - Intergenic
1028780502 7:94729795-94729817 AAACAGTGTTTCACAATGTTGGG - Intergenic
1029462406 7:100703660-100703682 AAACACTGGTTTAAAAAAAATGG - Intergenic
1029901076 7:104040372-104040394 AATAAGTGGTTAAGAAAGAAAGG + Intergenic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1030419595 7:109291301-109291323 AAACTGTAGTATACAAAGAAAGG - Intergenic
1030424437 7:109356274-109356296 AGATAGTGGTTCAGAAAGAAAGG + Intergenic
1030463735 7:109873743-109873765 AAAAAGTGGTTAACTATGAAAGG - Intergenic
1030491049 7:110235172-110235194 AGAGAGAGGATCACAAAGAATGG + Intergenic
1030611345 7:111692929-111692951 AAACTGAGGTTCAGAAATAAAGG - Intergenic
1030958337 7:115883913-115883935 AAACAGTGGATGAAAGAGAATGG - Intergenic
1031105827 7:117541523-117541545 AAACTGTGATTCTAAAAGAAGGG - Intronic
1031224880 7:119023389-119023411 AAACAGTGATTACCAGAGAATGG + Intergenic
1031402625 7:121343748-121343770 ACACAGTGATACACAAGGAAAGG + Intergenic
1031416269 7:121500087-121500109 AATCAGTGGTTCTCAAAGTGTGG + Intergenic
1033373953 7:140739131-140739153 AAGCAGTGGTTCACAAAATGTGG + Intronic
1033461722 7:141552382-141552404 AAACAGTGGTTTAGAGATAAAGG - Intronic
1034287541 7:149898049-149898071 AAACAGTGGCACACAAGTAAAGG + Intergenic
1034487680 7:151376181-151376203 AAACAGTGGTGCATAGACAAAGG - Intronic
1035944949 8:3952123-3952145 AAGTAGTGGTTCACAAAGTATGG + Intronic
1036086576 8:5618979-5619001 AAACAGAGGTCCACAGAGAGAGG - Intergenic
1036522023 8:9500737-9500759 AAACAGTTGTTGGTAAAGAAAGG + Intergenic
1037703999 8:21300447-21300469 AAAAAATGGTTGAAAAAGAATGG + Intergenic
1037870481 8:22490381-22490403 CAACAGTGGTTCTCAAAGTATGG - Intronic
1038444008 8:27590728-27590750 AAACAGTGGTTCCCACAGGCTGG + Intergenic
1038822760 8:30967985-30968007 AAAGAGTGGTTCACCAAGGCTGG - Intergenic
1039280361 8:35977759-35977781 ATACAGTGCTTCACAAAAGAGGG + Intergenic
1040431703 8:47349472-47349494 AAGCAGTGGTTCTCCTAGAATGG - Intronic
1042855739 8:73265450-73265472 ACACTGTGGAACACAAAGAAGGG + Intergenic
1043504286 8:80887173-80887195 AAACTGTGGTTCTCAAAGTATGG + Intergenic
1043991946 8:86765943-86765965 ACACAGTGGTTCTCAAAGTATGG + Intergenic
1044365114 8:91336138-91336160 AGAGTGTGGTTCAGAAAGAAGGG + Intronic
1044418814 8:91967501-91967523 AAACAGTGGTTCTGAAAGATTGG - Intronic
1044886501 8:96783948-96783970 AAACAGTGCTACTCAAAGCATGG - Intronic
1045013017 8:97975005-97975027 AAACATTGGTTCTCAAAGTGTGG - Intronic
1045195987 8:99931052-99931074 GTACAGTGGTTCTCAAAGTATGG + Intergenic
1046099471 8:109597969-109597991 AAACAGTGACTCTCAAAGAGTGG - Intronic
1046316173 8:112505121-112505143 AAGCAGTGGTAAAGAAAGAATGG + Intronic
1046477746 8:114769421-114769443 AAACTGTCCTTCACAAACAAAGG + Intergenic
1046632675 8:116636881-116636903 GAGCAGTGGTTCCCAAAGTATGG - Intergenic
1046796099 8:118373953-118373975 AAGCAGGGGTCCACAAACAATGG + Intronic
1047349583 8:124060932-124060954 TAACAGTGGTTCCCAAAGTGTGG + Intronic
1047695906 8:127403555-127403577 AAAGAGAGGGTCAGAAAGAAGGG - Intergenic
1047983577 8:130209328-130209350 CACCAGTGGTTCTCAAAGTATGG + Intronic
1048196892 8:132338799-132338821 AAGCAATGGTTCAGAAAGAAGGG + Intronic
1048733245 8:137467929-137467951 AAACAGAGGTGTGCAAAGAAAGG - Intergenic
1050052628 9:1619054-1619076 AAACAGTGGTTCATAACACAGGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050516984 9:6454999-6455021 CAGCAGTGGTTCTCAAAGTATGG - Intronic
1050656911 9:7838954-7838976 AAACAGTGATTCTCAAAGTATGG + Intronic
1050809248 9:9722795-9722817 AATCACTAGTTAACAAAGAAAGG - Intronic
1051214888 9:14786490-14786512 AACCAGTGGTTCTCAACGACAGG + Intronic
1051322446 9:15922268-15922290 AAACAGTGATTCTCAACTAAGGG - Intronic
1051942641 9:22527408-22527430 AAACAGTGCTTCAAATACAATGG + Intergenic
1051952342 9:22651411-22651433 ATACAGTTGTTCAGAAAGACTGG + Intergenic
1052532660 9:29707931-29707953 AAACAACGGTTCTTAAAGAAAGG - Intergenic
1052741504 9:32397222-32397244 AAAGAGTGGTGCAGAAAGAATGG - Intronic
1052768707 9:32668040-32668062 GAACAGTGGTTCTCAAAGTATGG + Intergenic
1052838058 9:33265871-33265893 AAACAGTGGTTCACAAAGAAGGG - Intronic
1054828708 9:69599631-69599653 AAACAGTGGTTCTCAAAGTGTGG + Intronic
1055131241 9:72777721-72777743 TAGTAGTAGTTCACAAAGAATGG + Intronic
1055370696 9:75595335-75595357 AAACAGTAGTTCCCAACGGAAGG + Intergenic
1055444647 9:76370464-76370486 AAACATTGGAACACAAAGAAAGG + Intergenic
1055529645 9:77171217-77171239 AGTCAATGGTTCACAAAGGAGGG + Intergenic
1055881250 9:81006796-81006818 AAATTGTGGTGTACAAAGAAGGG + Intergenic
1056571436 9:87819970-87819992 AAACAGTGGTTGCCAGAGACTGG + Intergenic
1056620759 9:88211869-88211891 AAACAGTGGGTTCCAAACAAAGG + Intergenic
1056651154 9:88464476-88464498 GAGCAGTGGTTCCCAAAGCAAGG + Intronic
1056667874 9:88596347-88596369 AGACAGTGGTAGGCAAAGAAAGG + Intergenic
1056916115 9:90747624-90747646 AGACAGGGTTTCACCAAGAATGG + Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1057842932 9:98500789-98500811 AAGCAGTGGTTCTCAAACAGTGG + Intronic
1057940429 9:99277558-99277580 AATCAGTGGTTTAAAAATAAAGG + Intergenic
1057960828 9:99455095-99455117 AACCAGTGGTTCTCAAAGTGTGG - Intergenic
1058018086 9:100058913-100058935 AAGCAGTGGTTCACAAACTGTGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058365921 9:104208237-104208259 ATACAGATCTTCACAAAGAAAGG + Intergenic
1058507059 9:105676784-105676806 AAAAAGTGTCTCACAAAGAGGGG - Intergenic
1058867754 9:109177221-109177243 TAGCAGTGGTTCCCAAAGTATGG + Intronic
1059047897 9:110890673-110890695 ATACAGTTATTCTCAAAGAAAGG - Intronic
1060358223 9:122931060-122931082 TCACAGTGGTTCTCAAAGACTGG + Intronic
1060574734 9:124680740-124680762 AAGCAGTGGTTCTCAAAGTATGG + Intronic
1062240320 9:135534148-135534170 AGGCCGTGGTTCACACAGAAAGG - Intergenic
1062678699 9:137764079-137764101 AACCAGTGGTTCTCAAAGTGTGG - Intronic
1185834919 X:3336513-3336535 AAGCAGTGGTTCCCAAAGGCTGG + Intronic
1186006069 X:5073742-5073764 AACCAGGGGTTCTCAAAGTACGG + Intergenic
1186188287 X:7043025-7043047 AAACAGTGGGAGACAAACAAGGG + Intergenic
1186225958 X:7399392-7399414 ATACATAGGTTCATAAAGAATGG - Intergenic
1186470827 X:9821011-9821033 AAGCAGTGGTTTTCAAAGTATGG + Intronic
1186525451 X:10244144-10244166 ACCCAGTGGTTCTCAAAGTATGG + Intergenic
1186552079 X:10516913-10516935 AAACGGTGGATAACAGAGAATGG - Intronic
1186839346 X:13469547-13469569 GCACAGTGGTTCTCAAAGCATGG - Intergenic
1186839539 X:13471353-13471375 AAACAGTGTTTCAGGCAGAAGGG + Intergenic
1186996401 X:15128201-15128223 TAACAGTGGTTCTCAAAGTGTGG + Intergenic
1187006314 X:15236388-15236410 AAACAGAGGTTGACAAACAATGG - Intronic
1187058855 X:15766675-15766697 AAACAATGTTTCCCAAAGGATGG - Intronic
1187431461 X:19228945-19228967 ATACAGTAGTTCTCAAAGAGTGG + Intergenic
1187453939 X:19424504-19424526 GAACAGTGGTTCTCAAAGTGTGG + Intronic
1187510536 X:19913666-19913688 ATACAGTGGTTCTCAAAGTGTGG - Exonic
1188454508 X:30347365-30347387 AAACACTGGGTTAAAAAGAAAGG + Intergenic
1188798735 X:34500090-34500112 GAACAGTGGTTACCAAAGACCGG + Intergenic
1188965924 X:36551087-36551109 AAACAGCAATTCACAAATAAAGG + Intergenic
1188987693 X:36782159-36782181 AAAAAGTGGTTTTCAGAGAATGG + Intergenic
1189752889 X:44240685-44240707 AATCAGTGGTTCTCAAACACTGG + Intronic
1189867539 X:45346671-45346693 GATCAGTGGTTCTCAAAGTATGG - Intergenic
1189871107 X:45383768-45383790 ATACAGTGGTTCTCAAAGGGTGG + Intergenic
1190450971 X:50580367-50580389 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1190553024 X:51604394-51604416 AAACAGGGGAGCACAAAGAAGGG + Intergenic
1190843873 X:54172844-54172866 AGCCAGTGGTTCTCAAAGTATGG - Intronic
1190982229 X:55466431-55466453 AAAAAAAGGTTCACTAAGAAAGG - Intergenic
1190986469 X:55506751-55506773 AAAAAAAGGTTCACTAAGAAAGG + Intergenic
1191661019 X:63650485-63650507 TATCAGTGGCTCAGAAAGAAAGG + Intronic
1192587747 X:72333251-72333273 AGACAGTGGAACAGAAAGAAGGG - Intronic
1193414209 X:81202093-81202115 AAACAGCGGTTGGCAGAGAAGGG - Exonic
1194047242 X:89023825-89023847 GAAAAGTGTTTCATAAAGAATGG + Intergenic
1195626329 X:107008348-107008370 AAGCACTGGTTCTCAAAGTATGG + Intergenic
1195831661 X:109066022-109066044 GAACAGTGATTATCAAAGAATGG - Intergenic
1196043682 X:111233320-111233342 AAACAGAGTTTCAAGAAGAAAGG - Intergenic
1196063557 X:111437839-111437861 AAACAATGAATCACAAAAAAAGG - Intergenic
1196117582 X:112014160-112014182 AAACAGTGGTTCTCAATGTATGG - Intronic
1196917243 X:120549838-120549860 AAACAGTCATTCAGAAGGAACGG - Intronic
1198511407 X:137355312-137355334 GAACAGTGGTTTTCAAAGTATGG + Intergenic
1199583569 X:149386715-149386737 GAACAGTAGTTCCCAAAGGAAGG + Intergenic
1199664574 X:150086541-150086563 AAACAGAAGCTCAGAAAGAAAGG - Intergenic
1199694049 X:150330956-150330978 CAACAGGGGTTCACAGATAAAGG + Intergenic
1199733239 X:150657978-150658000 AAATACTGGTACAAAAAGAATGG + Exonic
1200755048 Y:6983206-6983228 AATCAGTGGTTCTAAAAGAGAGG - Intronic
1201939337 Y:19442973-19442995 AATCAGTGCTTTACAAAAAAAGG + Intergenic