ID: 1052845571

View in Genome Browser
Species Human (GRCh38)
Location 9:33333197-33333219
Sequence CTTCCATCACTTTTCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052845571_1052845573 0 Left 1052845571 9:33333197-33333219 CCTTTTTGGAAAAGTGATGGAAG 0: 1
1: 1
2: 3
3: 29
4: 304
Right 1052845573 9:33333220-33333242 ATAAGGATATGCAAAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052845571 Original CRISPR CTTCCATCACTTTTCCAAAA AGG (reversed) Intronic
902709468 1:18228638-18228660 CTTCTATCCCTTTGCCACAAAGG + Intronic
903104846 1:21068005-21068027 CTTTCATCAGATTTTCAAAAGGG + Intronic
903321917 1:22548466-22548488 CTACCATCTCATTTCCAACAGGG - Intergenic
904061196 1:27712056-27712078 TTTCAATTACTTTTCCAAACTGG - Intergenic
906473677 1:46152262-46152284 CTGCCATCACTTCTCCATATCGG + Intronic
906897054 1:49786933-49786955 CTTTCATCAAGTTTCCAACAAGG + Intronic
907496781 1:54850623-54850645 CTCCCATCTCATTTCCAGAAAGG - Exonic
908221993 1:62016199-62016221 CTTCCATCACCTTTCCTAAGTGG - Intronic
908463105 1:64365531-64365553 CTTCCTTTTCTTGTCCAAAATGG - Intergenic
908708981 1:66993871-66993893 TTTCCAAGAGTTTTCCAAAAAGG - Intergenic
909317352 1:74240565-74240587 CTTCCATAGTTTTTTCAAAAAGG - Intronic
909596924 1:77416421-77416443 CTATGATTACTTTTCCAAAATGG + Intronic
911143239 1:94528162-94528184 TTTCCATAATTTCTCCAAAATGG + Intergenic
911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG + Intergenic
911388695 1:97211102-97211124 CTTGCCTCACTTTGCAAAAATGG + Intronic
911678629 1:100688960-100688982 CTTCCAGCACTATGTCAAAAAGG + Intergenic
914216629 1:145636522-145636544 TTTCCTTCACTGTTCCAAACAGG - Intronic
914469199 1:147959205-147959227 TTTCCCTCACTGTTCCAAACAGG - Intronic
915374300 1:155379134-155379156 CTTCCAGCATTTTGCCATAAGGG + Intronic
916534130 1:165687265-165687287 CTTCCATCACTTCTCCTTCAGGG - Intronic
917660684 1:177174121-177174143 CTGCCCTCCCTTTTCCAAGAAGG - Intronic
918409425 1:184243399-184243421 CTGCCTTCCCTTTTGCAAAATGG - Intergenic
918513642 1:185338847-185338869 CTTCCCTTTCTTTTACAAAATGG + Intergenic
918687917 1:187442699-187442721 CTCTCTTCACTTTTCCAAAGGGG + Intergenic
919167356 1:193912407-193912429 CTTCCATCCCTCATCCAAAGAGG - Intergenic
919680707 1:200431804-200431826 GTTCTATCAGTTTTCCACAATGG + Intergenic
919835996 1:201573758-201573780 CTTTCATCAGATTCCCAAAAAGG - Intergenic
920060589 1:203224440-203224462 CTTTCATCAGATTCCCAAAAGGG + Intronic
920944404 1:210515027-210515049 CTTCCAGCACCTGCCCAAAAGGG - Intronic
921769348 1:219017182-219017204 ATTCCATCATGCTTCCAAAAAGG + Intergenic
922541592 1:226424340-226424362 TTCCCATCCCTTTTCCTAAAAGG - Intergenic
922922094 1:229314167-229314189 CTTCCATCAAATTTTCTAAATGG - Intergenic
923099473 1:230800905-230800927 CTGCAATCACTTTCCTAAAAAGG + Intronic
1063122122 10:3112489-3112511 CAACCATCACCTTACCAAAAAGG - Intronic
1063948193 10:11197710-11197732 CTTCCATCTTTATTCCCAAATGG + Intronic
1064702898 10:18040175-18040197 ATTCCATAGATTTTCCAAAATGG + Intronic
1065878497 10:30018832-30018854 CTTCCATAATGTTTCCATAATGG - Intronic
1067076845 10:43192607-43192629 TTTGCTTCACTTTTCCCAAAAGG + Intergenic
1067076863 10:43192754-43192776 TTTGCTTCACTTTTCCCAAAAGG + Intergenic
1067938311 10:50630548-50630570 CTTCTGACTCTTTTCCAAAAAGG + Intergenic
1071707803 10:88018522-88018544 TTTGTATCTCTTTTCCAAAAAGG + Intergenic
1072191200 10:93077729-93077751 CTTGGATCAATTTTCCAAATAGG - Exonic
1072610448 10:97014190-97014212 CTTCCACCAGTGTTCCAAGAGGG - Intronic
1078405482 11:11067032-11067054 CTTCCATCATTTGTTCAGAAGGG - Intergenic
1079790798 11:24736793-24736815 CTTCCATCACTGTCTCAAACTGG - Intronic
1080534290 11:33206667-33206689 CTTTCCTCACTTTACCTAAAAGG + Intergenic
1081028390 11:38045282-38045304 ATTCCATCCATTTTCCAAAGAGG + Intergenic
1082721055 11:56677157-56677179 AATCCAACACTTTTTCAAAATGG + Intergenic
1082952176 11:58829195-58829217 CTTATATGACATTTCCAAAAGGG - Intergenic
1088518107 11:110660440-110660462 CTTCCAACAGTTTTCAAAAGGGG + Intronic
1089564753 11:119364585-119364607 CTTTCATCACGTTCTCAAAATGG - Intronic
1090040288 11:123284783-123284805 ATTTCCTCACTTTTCTAAAAAGG + Intergenic
1090695151 11:129232895-129232917 CTTCCCTCTCTCTTCCACAAGGG + Intronic
1092681274 12:10983707-10983729 CTCCCAGTACTTTTCCAGAAGGG - Intronic
1092684648 12:11028336-11028358 CTTCCAGCACTTTTCCAGAAGGG - Intronic
1092686968 12:11059213-11059235 CTCCCAGCACTTTTCCAGAAGGG - Intronic
1092689343 12:11089414-11089436 CTTCCAGCACTTTTTCCAGAAGG - Intronic
1092692696 12:11131240-11131262 CTCCCAGAACTTTTCCAGAAGGG - Intronic
1094744216 12:33325808-33325830 TTTCCATCTCTTTTCTAAAAAGG - Intergenic
1096450868 12:51739972-51739994 CTTCCCTTAGTTTCCCAAAAGGG - Intronic
1096684010 12:53275944-53275966 CATCTATCACTTCTTCAAAAAGG - Intronic
1097280280 12:57841124-57841146 TTTCCCTCACTTTTCTGAAATGG - Intronic
1099247506 12:80211834-80211856 TTTCCATCACTTTATCAAAGAGG - Intronic
1099456373 12:82867693-82867715 TTTCCATAACTTTTATAAAATGG + Intronic
1099608486 12:84835441-84835463 ATTCCTTCACTGTTGCAAAATGG - Intergenic
1100991829 12:100259691-100259713 CATCCATTAATTTTCTAAAAGGG - Intronic
1101074479 12:101114350-101114372 CTTCCATATCATTTCCATAATGG - Intronic
1101231914 12:102750041-102750063 CATCTATCTCTTTTCCTAAAGGG + Intergenic
1104986827 12:132601969-132601991 CTTGGATCACGTTTACAAAACGG - Intergenic
1106289815 13:28350385-28350407 CTCCCCTCCCTATTCCAAAAGGG - Intronic
1106890424 13:34239563-34239585 CTTCCATCATTCTGCCAACAAGG + Intergenic
1106949520 13:34867431-34867453 CTTTCATTGCTTTTCCAGAAGGG + Intergenic
1107285815 13:38790794-38790816 ATTAAATCACTTTGCCAAAAAGG - Intronic
1108192419 13:47955737-47955759 CTCCCAGCACTCTACCAAAATGG + Intronic
1109460108 13:62645206-62645228 CATCCATCTGTTTTCCAAACAGG - Intergenic
1110785355 13:79518203-79518225 CTTGCAGCACTTTTCCAAGTAGG - Intronic
1110822933 13:79937318-79937340 TTTCAATCAAATTTCCAAAAGGG + Intergenic
1111768455 13:92565220-92565242 TTTACATAAGTTTTCCAAAATGG + Intronic
1112842331 13:103595726-103595748 CTTCCTTCACGTTTTCAACAAGG - Intergenic
1113597539 13:111544872-111544894 CTTCATTCTCTGTTCCAAAATGG + Intergenic
1114306919 14:21431640-21431662 CCTCCATTACTTTCCCAAGATGG - Exonic
1117024973 14:51609824-51609846 TTTTCATCACATTTTCAAAAGGG - Intronic
1117032566 14:51689210-51689232 CTTCCTTCACTTCACCAACATGG - Intronic
1118513293 14:66500111-66500133 TTTCCTTCACTTTCCAAAAAAGG + Intergenic
1118607011 14:67511877-67511899 CAACCATCACATTTCCAAGATGG - Intronic
1120214025 14:81662632-81662654 CTTCCAGCTCCTTACCAAAATGG - Intergenic
1120394229 14:83947401-83947423 CTTCAATCTGTTTTCCATAATGG + Intergenic
1120434402 14:84462655-84462677 TTTCCATCTCTTTTATAAAATGG - Intergenic
1121323131 14:93004350-93004372 CTTTCCTAACTTTTCTAAAACGG + Intronic
1123540671 15:21286544-21286566 CTTCCATCTCTCTTATAAAAGGG - Intergenic
1123663817 15:22590435-22590457 CTTCCTTCACTTCACCAACATGG + Intergenic
1124317649 15:28684884-28684906 CTTCCTTCACTTCACCAACATGG + Intergenic
1124504401 15:30260813-30260835 ATTCCATCACCTTTCCCCAAAGG - Intergenic
1124565796 15:30812626-30812648 CTTCCTTCACTTCACCAACATGG - Intergenic
1124739150 15:32277822-32277844 ATTCCATCACCTTTCCCCAAAGG + Intergenic
1125740693 15:41962103-41962125 AATCAATCACTTTTCCAAGAAGG + Intronic
1125979911 15:43990852-43990874 CTTCAATGACTTTTACATAAGGG + Intronic
1126731331 15:51686227-51686249 TTTCCTTCACTATTCTAAAATGG - Intronic
1127579675 15:60326761-60326783 TCTCCATCAGTTTTCAAAAAAGG - Intergenic
1128319714 15:66684488-66684510 CTTCCCTCACAGTTGCAAAATGG - Intronic
1130286474 15:82559320-82559342 CTACCATGTCTTATCCAAAAGGG - Intronic
1202948982 15_KI270727v1_random:13687-13709 CTTCCATCTCTCTTATAAAAGGG - Intergenic
1133082379 16:3332948-3332970 CTTCCAACAGTTTTCCATACTGG + Intergenic
1133378971 16:5313979-5314001 CTTCCATCACATTCTCAAGAGGG + Intergenic
1140726169 16:77814599-77814621 CTTCTAGCATTTTTCCAACAGGG + Intronic
1143741745 17:8959498-8959520 CTTTCATCAGTTTTTCAAAGGGG + Intronic
1146854376 17:36251182-36251204 CTGCCAACACTTTTCCTGAAAGG - Intronic
1146870279 17:36375074-36375096 CTGCCAACACTTTTCCTGAAAGG - Intronic
1146877636 17:36426155-36426177 CTGCCAACACTTTTCCTGAAAGG - Intronic
1147073160 17:37975698-37975720 CTGCCAACACTTTTCCTGAAAGG - Intergenic
1147084682 17:38055236-38055258 CTGCCAACACTTTTCCTGAAAGG - Intronic
1147100629 17:38179202-38179224 CTGCCAACACTTTTCCTGAAAGG - Intergenic
1147415905 17:40289449-40289471 CTACAATCAGTTTTCCAAAAAGG + Exonic
1148883451 17:50751966-50751988 CTTACATTGCTTTCCCAAAAGGG - Exonic
1149326830 17:55539613-55539635 TTTCCATCAATCTTCCAAAAGGG - Intergenic
1153459667 18:5319534-5319556 CTTGCATCAGTTTTCCAGAATGG + Intergenic
1153771246 18:8418121-8418143 AATCCATCACTTTTCCAAAGTGG - Intergenic
1156552489 18:38032412-38032434 CTTGAAAAACTTTTCCAAAATGG + Intergenic
1158563481 18:58534836-58534858 CTTCCTTCTCTTTTGCAAGATGG + Exonic
1159023345 18:63161044-63161066 TTTAAATCACTTTTCCAAAATGG + Intronic
1160354940 18:78219323-78219345 ATTCAATCACTTTAGCAAAAGGG + Intergenic
1160366921 18:78334292-78334314 TTTTCTTCACTTTCCCAAAATGG + Intergenic
1161842242 19:6689456-6689478 CCTCCATCTCTTTTCCTAAGGGG + Intronic
1164403028 19:27915534-27915556 CTTCCATCACTTTTACAATATGG + Intergenic
925622058 2:5803803-5803825 AATCCATGACTTCTCCAAAAAGG - Intergenic
925776884 2:7344412-7344434 TTTCCATCAATTTTCCAGGAAGG - Intergenic
925777577 2:7349852-7349874 TTTCCATCAATTTTCCAGGAAGG + Intergenic
929753273 2:44739863-44739885 CTTCCATCAGTATTCAAACATGG - Intronic
930184637 2:48400694-48400716 ATGCCATAAATTTTCCAAAAAGG + Intergenic
930205255 2:48581186-48581208 CTGCCTTCATCTTTCCAAAATGG - Exonic
930304561 2:49662281-49662303 CTTTCTTCACTTTTTAAAAAGGG + Intergenic
930374944 2:50552858-50552880 CTTTCATCTCTTTGCCTAAATGG - Exonic
930840490 2:55839922-55839944 CTGACATCACTTACCCAAAAGGG - Intergenic
931504596 2:62910675-62910697 GTTCAATGACTTGTCCAAAAAGG - Intronic
931629020 2:64282944-64282966 CTTCCGTCACCTGTCCACAAGGG - Intergenic
933404023 2:81835062-81835084 CTTCATACTCTTTTCCAAAATGG - Intergenic
935018824 2:99211329-99211351 CTTCCCTCATTTTCCCTAAAAGG + Intronic
935456608 2:103276393-103276415 TTTCCATTATGTTTCCAAAAAGG + Intergenic
936125579 2:109787012-109787034 CTACCTTCACCTTTCCAGAAGGG - Intergenic
936219114 2:110584456-110584478 CTACCTTCACCTTTCCAGAAGGG + Intergenic
937377841 2:121349792-121349814 CTTCCATCTTTATTACAAAAGGG - Intronic
937668978 2:124518494-124518516 CTTCCAGAATTTTTCCAAAGTGG - Intronic
939375868 2:141366271-141366293 CTCCCACCAGTTGTCCAAAAGGG - Intronic
941268178 2:163390351-163390373 GTGCCACCATTTTTCCAAAAAGG + Intergenic
941459517 2:165752281-165752303 CTAAGATCGCTTTTCCAAAAAGG + Intronic
942229940 2:173851390-173851412 AGTCCATCACTTTTCCAGACTGG + Intergenic
942397475 2:175567205-175567227 CTTCCATCATCTTTCCAAACAGG + Intergenic
944189532 2:196986437-196986459 CTTCCAACTTTTTTCCATAAAGG - Intronic
945464099 2:210146460-210146482 CTTGCATAACTTCTGCAAAAGGG + Intronic
945507644 2:210661005-210661027 CTTACATGACTTTTGTAAAAAGG + Intronic
945631675 2:212286421-212286443 CTTCAGTAACTTTTTCAAAAAGG + Intronic
946617333 2:221523944-221523966 TTTCCATCAATTTAACAAAAGGG - Intronic
947274668 2:228376824-228376846 CTTCCAACACATTGGCAAAAGGG - Intergenic
947599783 2:231439630-231439652 GGTCAAACACTTTTCCAAAATGG + Intergenic
948359605 2:237410611-237410633 ATTTCATCTCTTTCCCAAAATGG + Intronic
949053942 2:241914464-241914486 CTTCCATTTAATTTCCAAAATGG - Intergenic
1169015119 20:2285787-2285809 CTTCCATATCTTTTCAAATAAGG - Intergenic
1169355868 20:4904568-4904590 ATTCCATCACGTTAGCAAAATGG - Intronic
1170775858 20:19374160-19374182 TTTCCATCATGTTTCAAAAATGG + Intronic
1170938305 20:20828117-20828139 CTTCCCTCACTCCTCCACAAGGG - Intergenic
1171308749 20:24128497-24128519 CTTCTTTCACATTTGCAAAATGG - Intergenic
1173168682 20:40704709-40704731 CTTTCTTCAGTTTTCCAAGATGG + Intergenic
1173496305 20:43520932-43520954 CTTTCATTACATTTTCAAAAAGG + Intronic
1175225084 20:57439894-57439916 CTAGCATCAGTTTACCAAAATGG - Intergenic
1175770888 20:61623396-61623418 CTTCAATCACTGTTCTAAACGGG - Intronic
1178211177 21:30534049-30534071 TTTTCATCACTTTTACAAAGAGG - Intergenic
1179090183 21:38257654-38257676 CTTACATAACTTTTCTCAAAAGG - Intronic
1179129171 21:38619098-38619120 CTTCCCTGACTTCTCCAAGATGG + Intronic
1179944766 21:44665760-44665782 CTCCCATCACTGGTCCACAAAGG - Intronic
1182391101 22:29997130-29997152 CTTCTAAAACTTTTCCAAAATGG + Intronic
1182604337 22:31491482-31491504 CTTTCCTCATTTTTCCGAAAGGG + Intronic
1182746504 22:32609952-32609974 TTTCCTTCACATTTCTAAAAGGG - Intronic
1182945643 22:34319260-34319282 CTTCCATCAGTTTCTCAAGAAGG - Intergenic
1185357418 22:50382100-50382122 CTTCCATCACTATTCTCAAGTGG - Intronic
949677656 3:6475407-6475429 CTTTCATCAGTTTTTCAAAAGGG + Intergenic
949773184 3:7601311-7601333 CTTTCACCACATTTCCAAAGAGG + Intronic
950080386 3:10217931-10217953 CTTCCCTCATTTTTCAAAAGAGG + Intronic
950242763 3:11386629-11386651 TTTCCTTCTCCTTTCCAAAAGGG + Intronic
950711066 3:14813199-14813221 ATTTCATCATTTTACCAAAAAGG + Intergenic
951159851 3:19405860-19405882 CTTCCATTCATTTTCCCAAAGGG - Intronic
952524618 3:34197088-34197110 CTGCCAAAACTTTTCCAAAGTGG - Intergenic
952751191 3:36826272-36826294 CTTACACCACTTTCCCAAAAGGG + Intergenic
953938551 3:47069147-47069169 ATTACCTCAATTTTCCAAAAAGG + Intronic
954867509 3:53742530-53742552 CCTACATCACTTTTCCACAGAGG - Intronic
956434276 3:69218429-69218451 TTTAAATCACTTTTCCCAAAAGG - Intronic
956496712 3:69834744-69834766 CTTCCTACTGTTTTCCAAAATGG + Intronic
958929076 3:100190033-100190055 CTACCATCATTTTTCCTGAAAGG - Exonic
959258570 3:104046846-104046868 CTTTCATCACTTTCACAAAGGGG + Intergenic
959855936 3:111158514-111158536 TTTACATCATTTTTCTAAAAAGG - Intronic
960497443 3:118392175-118392197 CTTCTATCACTATGGCAAAAAGG - Intergenic
963564640 3:146913236-146913258 CTGCCATCTCTTTTCTAATATGG - Intergenic
965185913 3:165463231-165463253 CTTCTATCATTTTTCAAACATGG + Intergenic
965403635 3:168244507-168244529 CTTCATACACTTTTCCATAACGG - Intergenic
965492556 3:169357297-169357319 CTTACAGCATTTTTCCTAAAAGG + Intronic
966036038 3:175416211-175416233 CTTCCAATAGTTTTCTAAAATGG + Intronic
967503597 3:190227900-190227922 TTTCCATCAATTTTCTAATAAGG + Intergenic
967847695 3:194057198-194057220 CTGCCAGCACGTGTCCAAAACGG + Intergenic
967961044 3:194924477-194924499 CCTCCACCACCATTCCAAAAGGG - Intergenic
968272668 3:197416519-197416541 GTTCCATTACTATTCCCAAAAGG - Intergenic
968277122 3:197448592-197448614 CCTCCACCACCATTCCAAAAGGG + Intergenic
969961608 4:10949970-10949992 CTTCCCTTACTCTTCCAACAAGG + Intergenic
970763456 4:19518411-19518433 CTTCCCTCCCTTTTCCACACTGG - Intergenic
971039417 4:22735035-22735057 CTTCCTTCTCTTTTCCTCAAAGG + Intergenic
972472835 4:39423575-39423597 CTTCAATTTCTTTTCTAAAATGG + Intronic
973962593 4:56126646-56126668 CTTTCATCAGATTTTCAAAATGG - Intergenic
975333591 4:73149475-73149497 CTTCCCCCACTTCTCCAAAAAGG - Intronic
976188181 4:82463847-82463869 CTTCCATCTCTTCTCCAATTAGG + Intergenic
977157023 4:93586899-93586921 CTTCCATGAATTTTTTAAAAGGG - Intronic
977243905 4:94606506-94606528 CTTCCATCTCTTTTTGAAATAGG - Intronic
977936610 4:102813174-102813196 TTCCCATCACTTTTTTAAAAGGG - Intronic
978077128 4:104545461-104545483 CTTCCTTCTCTTTTCAATAAAGG + Intergenic
978080586 4:104585728-104585750 CATCCATCCATTTTTCAAAATGG - Intergenic
978402616 4:108346910-108346932 ATTCCATCACTGTTCCAGCAAGG + Intergenic
979029597 4:115625421-115625443 CTGTCATCTCTTTTCCAAAGTGG + Intergenic
979036900 4:115732104-115732126 ATTTCATTACATTTCCAAAAAGG + Intergenic
979103480 4:116653588-116653610 CCTCAATCACCTTTCCAAGAAGG - Intergenic
979269384 4:118742359-118742381 CCCCCCCCACTTTTCCAAAAAGG - Intronic
979401058 4:120250496-120250518 ATTTTATCAGTTTTCCAAAATGG + Intergenic
979841950 4:125452615-125452637 CTTCCATCACCTTGCCACAGTGG + Exonic
979996272 4:127435142-127435164 CTTCCAGACCTTTTCCAAAGTGG - Intergenic
981988758 4:150890101-150890123 CTTCCATCTTTTTTCCCCAAAGG - Intronic
982307568 4:153948989-153949011 CTTCCCTCACTTTTCCAAAAAGG - Intergenic
983612582 4:169665702-169665724 CTTCCATAATTTTTTTAAAAAGG + Intronic
984547004 4:181118305-181118327 TTTCCATTTCTTTTTCAAAATGG + Intergenic
986582971 5:9284523-9284545 CTTCCATTCCTTTTCTATAATGG + Intronic
987053814 5:14171918-14171940 CTTTGCTCACTTTTGCAAAATGG - Intronic
987163409 5:15168913-15168935 CTTCCATCACTGCCCCACAATGG + Intergenic
987917730 5:24237486-24237508 ATTCCATCTCTCTTCCAAAAAGG + Intergenic
989073811 5:37541096-37541118 ATTGCCTCACTTTTCAAAAAGGG + Intronic
989454943 5:41633159-41633181 CTTCCAAAATTTTTCCAAAATGG - Intergenic
989478269 5:41899317-41899339 CTTCCAGCTGTTTTTCAAAATGG + Intergenic
990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG + Intronic
990557911 5:56953061-56953083 CTTCCCTCACTTCTCCAAAAAGG + Intronic
993263335 5:85690479-85690501 CTTACTACACTTTTCCACAATGG + Intergenic
993480675 5:88420948-88420970 CTTGAATCATTTTTTCAAAATGG + Intergenic
994163204 5:96580079-96580101 CTTCCTTCTCTTTTCCCATAAGG + Intronic
994723960 5:103413031-103413053 CTTCCTTCACTTTTCATAAAAGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996216734 5:120876602-120876624 CTTCCAAAAGTCTTCCAAAATGG + Intergenic
997510397 5:134449892-134449914 CTTCCATCACATCTCCAAGTTGG - Intergenic
997693051 5:135840148-135840170 TATTCATCACTTTTCCAAAGAGG + Intronic
997902579 5:137780906-137780928 CATCCTTCTCTTTTCCAAATGGG - Intergenic
998150894 5:139756842-139756864 CTTCCCGCACTCTTCCACAAGGG + Intergenic
998320760 5:141228011-141228033 CATCATTCACTTTTCCACAAAGG - Intergenic
998681395 5:144471464-144471486 ATTTCTACACTTTTCCAAAAAGG + Intronic
998890491 5:146740766-146740788 CTACCATCATTTTTTCAAAATGG - Intronic
999664406 5:153897866-153897888 CTTCCACTACCTCTCCAAAATGG - Intergenic
999821918 5:155237127-155237149 CTTCCATCAGTCCTCCAAACTGG - Intergenic
1000139795 5:158391026-158391048 CTTATATCACTTTTTCCAAAAGG - Intergenic
1000475731 5:161704711-161704733 CTCTCATCATTTGTCCAAAAAGG + Intergenic
1000652120 5:163830719-163830741 CTTCTTTGAGTTTTCCAAAAAGG - Intergenic
1001668947 5:173457830-173457852 CATCCTCCCCTTTTCCAAAAAGG - Intergenic
1002486187 5:179538782-179538804 ATTCCATCTCTTTTTTAAAAAGG + Intergenic
1002871929 6:1174402-1174424 CTTTCATCAGATTTTCAAAAGGG + Intergenic
1003273133 6:4624623-4624645 CTTCCATCACCTTCCCAAATGGG + Intergenic
1003707826 6:8554388-8554410 GTTTTATCAGTTTTCCAAAATGG - Intergenic
1005407883 6:25510877-25510899 TTTCCATTACTTTTTAAAAATGG + Intronic
1006890915 6:37427387-37427409 CTTACTTCACCTTTCCAAAAAGG + Intergenic
1006977588 6:38117852-38117874 CTTCCTTCCCATTTCCAATAGGG - Intronic
1006979046 6:38131856-38131878 TTTCAAACACTGTTCCAAAAGGG - Intronic
1007216343 6:40242838-40242860 CTCCCATCACATTTTCAACAAGG - Intergenic
1008418744 6:51272644-51272666 CTTCCACCATTTTTTCAAATGGG + Intergenic
1009579864 6:65518334-65518356 CCTTCATCTCTTCTCCAAAAAGG + Intronic
1009742455 6:67764403-67764425 CCACCATCTCTTTTCCAAAATGG - Intergenic
1009810799 6:68663270-68663292 CTTCCAACAACTTTTCAAAATGG - Intronic
1009929120 6:70155253-70155275 CTTCCATCCTTTTCCCTAAAGGG - Intronic
1010312492 6:74403738-74403760 CTTCTATCTCTTTTCCCAAAGGG - Intergenic
1010752012 6:79626401-79626423 CTACCATCAAATTTCCAAAGAGG + Intergenic
1010780329 6:79938329-79938351 CTTCCATCTTTTTTGCTAAAGGG - Intronic
1011164821 6:84434621-84434643 GTTCCATCACTTTTCCCATCTGG + Intergenic
1013389308 6:109667129-109667151 TTTCCATCACTATTTTAAAAGGG - Intronic
1014693233 6:124587569-124587591 CTTCAATAACTTCTCCACAAAGG - Intronic
1015485362 6:133763999-133764021 CTTTCCTAACTTTTCCAAAACGG + Intergenic
1016223854 6:141709332-141709354 CTTCAATTACATTTCTAAAATGG - Intergenic
1017505187 6:155062114-155062136 CTTCAATCCCTTTTCCTAAGTGG - Intronic
1018501964 6:164421085-164421107 CATCCATTACTTCTCTAAAATGG + Intergenic
1026067517 7:67088412-67088434 CTACCACCAGTTTTCCAGAAGGG - Intronic
1026542988 7:71297088-71297110 CTTCCATCACTTTCGCCAGATGG + Intronic
1029777699 7:102695874-102695896 CTTCAATCAGTTTTCCAAAGAGG - Intergenic
1030019693 7:105261132-105261154 TTTCCATCTCTGTGCCAAAATGG - Intronic
1030364013 7:108625866-108625888 TTTCCATTACTTTTCCCAGAAGG + Intergenic
1030515752 7:110535519-110535541 CTTCTTTCACTTTTTAAAAATGG - Intergenic
1031570848 7:123357411-123357433 CTTCTCTCACTTTTCCATAATGG - Intergenic
1031654505 7:124336640-124336662 CTCCCTTTCCTTTTCCAAAAAGG + Intergenic
1033569895 7:142617489-142617511 CCTCCCTCACTTTACCCAAAAGG + Intergenic
1033730785 7:144176966-144176988 CTTCCAACAATGTTCCAAAGAGG + Intergenic
1033771565 7:144558228-144558250 CCCCCATCACTCTTCCAAACTGG + Intronic
1033818049 7:145099238-145099260 CTTTCCTCAGTTCTCCAAAATGG - Intergenic
1034720876 7:153291305-153291327 CTTGCATAACATTTCTAAAATGG + Intergenic
1037292379 8:17364984-17365006 CCTCCATCTGTTTTCCATAATGG + Intronic
1038185812 8:25273815-25273837 ATTTGATCAGTTTTCCAAAATGG + Intronic
1041433726 8:57814994-57815016 ATTCCAAGAATTTTCCAAAAAGG + Intergenic
1042444693 8:68870607-68870629 CTTTCATTAGTTTTACAAAAGGG + Intergenic
1044371830 8:91420997-91421019 CTTGCAACTTTTTTCCAAAATGG + Intergenic
1045066729 8:98454134-98454156 CTTCCATTCCTTTTTAAAAATGG - Intronic
1046123771 8:109879029-109879051 ATTCTATCATTTTTCCAAGAAGG - Intergenic
1046350629 8:113006416-113006438 CTTCCACTACTTTTTCAGAAAGG - Intronic
1046966070 8:120167184-120167206 CTTCCATCCCTTTGCTGAAATGG - Intronic
1047635462 8:126756824-126756846 CTTCCATCAGTTCTTCAAAAGGG + Intergenic
1048057946 8:130886588-130886610 TTTCCATCTCTTCTCCAAGACGG - Intronic
1048178881 8:132177428-132177450 CTCCCATCACTTTTCCATATTGG - Intronic
1048184554 8:132227632-132227654 CTTCAATCAGGTTTCCACAAAGG - Intronic
1048315748 8:133360690-133360712 CTACCATCTCTTTTACAAAGGGG - Intergenic
1048681965 8:136853016-136853038 TGGCCATCACTTTTACAAAAGGG + Intergenic
1049979464 9:891036-891058 CTTGTTTCACTTTTCTAAAAAGG - Intronic
1050078334 9:1888651-1888673 TTTCCATCACTTTTCGGGAAAGG - Intergenic
1050375650 9:4970215-4970237 CTTCCACCACTTTTTTTAAACGG - Intergenic
1050527043 9:6555209-6555231 CTTCCATCACTGTGCCCAACGGG - Intronic
1051038247 9:12775700-12775722 CTTCCATGACTTTTCCGGAACGG - Exonic
1051163817 9:14239152-14239174 CCTCCATCATTTAACCAAAAAGG + Intronic
1051324994 9:15956644-15956666 CTTAGATCATTTTTCAAAAAAGG + Intronic
1052845571 9:33333197-33333219 CTTCCATCACTTTTCCAAAAAGG - Intronic
1056422128 9:86438802-86438824 CTTCCATCACTTTTCTACCTAGG + Intergenic
1057881402 9:98795664-98795686 CTTCCCCCACGTCTCCAAAATGG + Intronic
1058035715 9:100250148-100250170 CTTACAGCACTTTTCAAAGAGGG - Intronic
1058861453 9:109120907-109120929 ATCCCAGCACTTTTCCAATAGGG - Intergenic
1059077665 9:111211173-111211195 CTTCCATCTCTTTTTAAAATTGG + Intergenic
1060222270 9:121770879-121770901 CTTCCCTGATTTTTCCCAAATGG - Intronic
1061297692 9:129685940-129685962 CTTCCCTCACTGGTCCAGAAAGG - Intronic
1202629851 M:7499-7521 CCTCCATGACTTTTTCAAAAAGG + Intergenic
1186443075 X:9602801-9602823 CTTTCCTGACATTTCCAAAAGGG - Intronic
1187036812 X:15549266-15549288 CTTTCATCAGATTCCCAAAAGGG + Intronic
1187320625 X:18234581-18234603 GTTCCTACACTTTTCCCAAAGGG - Intergenic
1188088007 X:25926012-25926034 CTTCCAAACCTTTTTCAAAACGG + Intergenic
1189720464 X:43910816-43910838 CTTCCTTCCCTTTTAGAAAATGG + Intergenic
1190389102 X:49913980-49914002 CTTCCATGACTCTACCAAAATGG - Intergenic
1192669772 X:73127607-73127629 CTGCCGTCTCTTTTCCAATAAGG + Exonic
1193219501 X:78906554-78906576 CTTCAATCTGTTTTCCATAATGG + Intergenic
1193428509 X:81370846-81370868 CTACCATAACTCTTCCACAAAGG - Intergenic
1193737495 X:85176225-85176247 CTTTCATATCTTTACCAAAATGG - Intergenic
1193742171 X:85230976-85230998 CTTCCATACTTTTTCCATAATGG - Intergenic
1194338073 X:92673881-92673903 CTCCCATCACTGTTGCAATAAGG - Intergenic
1196065291 X:111457683-111457705 CTTCGATTCCTTTTACAAAATGG + Intergenic
1198427264 X:136532482-136532504 CTTACCGCACTTCTCCAAAATGG - Intronic
1200646475 Y:5790616-5790638 CTCCCATCACTGTTGCAATAAGG - Intergenic
1200756385 Y:6994030-6994052 CTTTCCTTACATTTCCAAAAGGG - Intronic
1201607098 Y:15799104-15799126 CTTCGTTCATTTTTCCAATATGG + Intergenic
1201744529 Y:17357189-17357211 CTGCCTTCTCTTTTCCCAAAGGG + Intergenic