ID: 1052845738

View in Genome Browser
Species Human (GRCh38)
Location 9:33334758-33334780
Sequence TGACAAGGCAGATCCACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052845738_1052845740 -1 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA No data
Right 1052845740 9:33334780-33334802 ATAGTTCACCATGACCCTTTTGG No data
1052845738_1052845741 2 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA No data
Right 1052845741 9:33334783-33334805 GTTCACCATGACCCTTTTGGTGG No data
1052845738_1052845743 11 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA No data
Right 1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052845738 Original CRISPR TGACAAGGCAGATCCACATA TGG (reversed) Intronic