ID: 1052845738

View in Genome Browser
Species Human (GRCh38)
Location 9:33334758-33334780
Sequence TGACAAGGCAGATCCACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052845738_1052845743 11 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG No data
1052845738_1052845741 2 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1052845741 9:33334783-33334805 GTTCACCATGACCCTTTTGGTGG No data
1052845738_1052845740 -1 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1052845740 9:33334780-33334802 ATAGTTCACCATGACCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052845738 Original CRISPR TGACAAGGCAGATCCACATA TGG (reversed) Intronic
905518523 1:38579702-38579724 TGACAAGGCAAGTCCCCCTAGGG - Intergenic
917274219 1:173313791-173313813 TGACTAGACAGTTCCAAATAAGG - Intergenic
918099418 1:181360844-181360866 TGTAAAGGCTGAGCCACATATGG - Intergenic
920423980 1:205858608-205858630 TGATGAGGCAGATTCAGATAAGG + Intergenic
923636040 1:235697626-235697648 TGACAAGCCATATGTACATATGG + Intronic
1064392244 10:14952005-14952027 TGACTAAGCAGATCCACATGTGG + Intronic
1066473888 10:35725701-35725723 GGACAGGACAGATCCACAGACGG - Intergenic
1069107949 10:64406671-64406693 TGACAAGTCAAAACCACATAGGG + Intergenic
1069941312 10:71957464-71957486 TGACAAGACAGATTCAGATGAGG + Intergenic
1079255124 11:18821261-18821283 TGATGAGGCAGATTCAGATAAGG - Intergenic
1079590107 11:22172744-22172766 AGACAAGGGAGATACAAATATGG - Intergenic
1079930618 11:26555403-26555425 AGACAAGAAATATCCACATATGG + Intronic
1081557511 11:44179147-44179169 TCACAAGCCAGATCCAGATGGGG + Intronic
1082265626 11:50114870-50114892 TCACAAAGCAGCTTCACATAGGG + Intergenic
1082290461 11:50363700-50363722 TCACAAAGCAGCTTCACATAGGG - Intergenic
1083387073 11:62319078-62319100 TGAGAAGGAAGATCCAGAGAAGG + Intergenic
1092737969 12:11601632-11601654 TGCCATGGCAGATCTACACAGGG - Intergenic
1097408222 12:59217960-59217982 TGAGGAGGCAGTTTCACATATGG - Intergenic
1102067726 12:109992026-109992048 TGAAATGGTAGATCCACATTAGG - Intronic
1104014205 12:124951411-124951433 AGAACAGGCAGATCCACAGATGG + Intronic
1104691508 12:130829706-130829728 AGACAAGGCAGATAGCCATAGGG - Intronic
1104698412 12:130882248-130882270 AGACCACGCAGATCCACAGACGG - Intergenic
1104698431 12:130882382-130882404 AGACCACGCAGATCCACAGACGG - Intergenic
1104698450 12:130882516-130882538 AGACCACGCAGATCCACAGACGG - Intergenic
1104698486 12:130882788-130882810 AGACCACGCAGATCCACAGACGG - Intergenic
1105430949 13:20336960-20336982 TGACAAAGACAATCCACATAGGG - Intergenic
1105935324 13:25093485-25093507 TGAAAAGGAAGCTCCACAAAAGG + Intergenic
1111661338 13:91216213-91216235 TGGCAAGGGAGATCCACTTCTGG - Intergenic
1113583037 13:111442067-111442089 TGAAAAGTAAGACCCACATATGG - Intergenic
1114808987 14:25873701-25873723 CGTCAAGGCAGAGCCACATGGGG + Intergenic
1123146813 14:106141263-106141285 TTAGGAGGCAGATCCACATCAGG - Intergenic
1128697950 15:69782354-69782376 TGGCAAGGCAGACCAACTTAAGG - Intergenic
1131321847 15:91401149-91401171 AGAAAAGGCAGAGTCACATATGG + Intergenic
1131408809 15:92188771-92188793 AGACAATGGAGACCCACATAGGG + Intergenic
1133091182 16:3404919-3404941 AGAAAAGACAGATCCAAATATGG + Intronic
1133378873 16:5313317-5313339 TGACAAGACAGCTCTAGATATGG + Intergenic
1149811411 17:59677119-59677141 TGAGAAGAGAGATCCACATCTGG + Exonic
1150664120 17:67114611-67114633 TGACAAGGCAAAGCCTAATAAGG + Intronic
1154473674 18:14730259-14730281 TGAGAAGGCATATCCAGAGAGGG + Intronic
1157625892 18:49050865-49050887 TGACATGCCAGATGCTCATAAGG - Intronic
1162693339 19:12451617-12451639 TGACAAGGCAGATTCAGATGAGG + Intronic
1163923977 19:20321281-20321303 TGACAAGGCAGATTCAGAAGAGG - Intergenic
927875021 2:26649539-26649561 TTACAAGGCATTTCCACAGATGG - Intergenic
929923060 2:46186786-46186808 TGACCAGCCAGATGCAAATATGG - Exonic
935701403 2:105815446-105815468 TGTCAAGACAGATCCCCATTGGG + Intronic
935722364 2:105990685-105990707 TGATGAGGCAGATTCACATGAGG + Intergenic
935920107 2:108003572-108003594 TGACAAGTCATCTTCACATAGGG - Intronic
941077040 2:161017536-161017558 AGCCAAGGCAGATCCACTAAAGG + Intergenic
943376125 2:187078811-187078833 TAACAAAGCAGATTCACAGATGG + Intergenic
944649024 2:201810298-201810320 TGAAAAGTCAGTTTCACATATGG + Intronic
945420870 2:209634441-209634463 TGACAAAGCAAAGCCACACATGG - Intronic
947474854 2:230435026-230435048 TGACCATGCAGATCCACTTTTGG - Intronic
1172211114 20:33199207-33199229 CAACAAGTCAGAGCCACATAGGG + Intergenic
1174536532 20:51255622-51255644 TGACAAGTCACATCCTCAGAGGG - Intergenic
1178347669 21:31845536-31845558 TGACAATTCAGATCCACACAGGG + Intergenic
952449275 3:33416010-33416032 TAAAAAGGCAGATCCACAGAGGG + Intronic
952968016 3:38632981-38633003 TGACAAGGGAGTTGCACAGAAGG + Intronic
953922081 3:46959250-46959272 TGAGAAAGCAGAACCACATGAGG + Intronic
954861660 3:53695528-53695550 TGACAAGGAAGGTCCACATGAGG + Intronic
956873188 3:73438211-73438233 AGACAAGGCATATACACAAAGGG + Intronic
957285004 3:78206960-78206982 TGACAAGGAAGGGACACATATGG - Intergenic
957555385 3:81760111-81760133 TCACAAGGCTGCTCCTCATATGG + Intronic
961537529 3:127579089-127579111 TGAGAAGGCAGCTCCAAATGTGG - Intronic
962256079 3:133871180-133871202 TGACAAAGCAGATGCACCTCTGG + Intronic
963674809 3:148296601-148296623 TGACAAGGTAGTGCCACACAGGG + Intergenic
963767366 3:149351590-149351612 TGAGAAGGCTGAGGCACATAGGG + Intergenic
964539548 3:157764344-157764366 AGAGAAGGAAGATCCAGATATGG + Intergenic
969242287 4:5907744-5907766 TGACAAGGAAGATCCAGCCATGG + Intronic
972079517 4:35133162-35133184 TGACAATGTAGAGCAACATATGG - Intergenic
972975247 4:44626476-44626498 TGAAAAGGCAGTTCTACAAATGG + Intronic
974002608 4:56526640-56526662 TGAAAAGGCAGATCCACTCTTGG - Intergenic
974371887 4:61028119-61028141 TGACAAGGCATTTCCAAATTTGG - Intergenic
974845860 4:67350751-67350773 TGAGAAGGCAGAGCCAGCTATGG + Intergenic
975350064 4:73335913-73335935 AGAGAAGGCAGAGCCACAGATGG - Intergenic
978305953 4:107328884-107328906 TGATAAGGCAGATTCAGATGAGG + Intergenic
986158028 5:5196373-5196395 TGACAAAGCACAGCCACAAATGG - Intronic
987502401 5:18730868-18730890 TGAGAAGGCATATCCAGAGAGGG + Intergenic
989925033 5:49862581-49862603 TGAAAAGGAAGATTCACATTCGG - Intergenic
989926951 5:49891199-49891221 TGAAAAGGAAGATTCACATTCGG - Intergenic
989929762 5:49932921-49932943 TGAAAAGGAAGATTCACATTCGG - Intergenic
992490655 5:77240550-77240572 TGACAAGGCAGATGTACACTAGG - Intronic
992519631 5:77537342-77537364 TGCCCATGCAGATCCACATGGGG + Intronic
993015439 5:82530525-82530547 TCACAAAACAGCTCCACATAAGG + Intergenic
994692147 5:103032788-103032810 CGACAGGGCAGATACACATTCGG - Intergenic
995963128 5:117869745-117869767 TGCCAAGGAAGATACACAGATGG + Intergenic
998563244 5:143191883-143191905 TGTCACGACAGCTCCACATATGG - Intronic
1000198339 5:158982925-158982947 TAACAAAGCAGTTCCTCATAGGG - Intronic
1004661593 6:17715457-17715479 TGAGGAGGCAAATCCACAAAGGG + Intergenic
1005089657 6:22043296-22043318 GGACAAGGTGGATCCACAGAAGG - Intergenic
1009847718 6:69154439-69154461 TGACAAGGCAGAGGTACAGAAGG - Intronic
1011493768 6:87919052-87919074 GGACTAGCCATATCCACATATGG - Intergenic
1013184776 6:107748236-107748258 TGAGAAGGCAGATACACAAGAGG - Intronic
1022552686 7:31256400-31256422 TGACAAAGCAGATCAACAGGAGG + Intergenic
1022575617 7:31494167-31494189 TGACAAGGAAAATCCACGCATGG - Intergenic
1023572032 7:41582202-41582224 AGACAAGCCAGATCTACATAAGG - Intergenic
1025219984 7:57099131-57099153 TGCCAAGGCAGATAAACATACGG - Intergenic
1025630764 7:63270680-63270702 TGCCAAGGCAGATAAACATACGG - Intergenic
1025651708 7:63475925-63475947 TGCCAAGGCAGATAAACATACGG + Intergenic
1033470150 7:141639871-141639893 TGACAAGGCTGATCCAGAACTGG + Intronic
1034113048 7:148557222-148557244 AGACCAGGCAGGTCCACCTACGG + Intergenic
1034699418 7:153083511-153083533 TGACAAGGCAGGGCCACCTCAGG - Intergenic
1036782299 8:11658153-11658175 TGACAAGGCAGCTCCGAATCAGG - Intergenic
1037929289 8:22868109-22868131 TGACAAGGCAGCTAAACAGAGGG - Intronic
1038244308 8:25840482-25840504 TGACAAGGCAGGGCCACCTCTGG + Intergenic
1039901386 8:41755255-41755277 TGACAAGGCAGTTACACCCAAGG + Intronic
1040121045 8:43686392-43686414 TCACAAGGCAGTTTCACAGATGG - Intergenic
1044277622 8:90321053-90321075 TGACCAGGCAGATGGAAATAAGG - Intergenic
1045038443 8:98196402-98196424 TGACATGGCAGGTCCACCTCAGG + Intronic
1047374884 8:124286511-124286533 TCACATGGCAAATCCACATGAGG - Intergenic
1047811038 8:128409426-128409448 TGACAAGCCAGATCCTCCCAAGG - Intergenic
1050168909 9:2795337-2795359 TTACAAGGCATCTTCACATATGG + Intronic
1052845738 9:33334758-33334780 TGACAAGGCAGATCCACATATGG - Intronic
1056632671 9:88306549-88306571 TGAAAAGGCAAATCCATATTTGG + Intergenic
1057143616 9:92743658-92743680 TGACAGGGCAGAAGCACAGATGG + Intronic
1057217596 9:93238050-93238072 TGACAGGGCAGAGCCAAATGCGG - Intronic
1059808802 9:117833507-117833529 TGTCAAGGGAGAACCACATTTGG + Intergenic
1060647035 9:125289699-125289721 TGACTAGGCAGTTGCATATATGG + Intronic
1060991053 9:127849411-127849433 TGACCAGCCAGTTCCACAAATGG - Intronic
1189459331 X:41225079-41225101 TGCAAAAGCAGATCCAAATAGGG - Exonic
1189505292 X:41607064-41607086 TGACAGGGCAGATGCCAATAAGG + Intronic
1196403737 X:115342993-115343015 TGAGAAGGTAGATACACAGATGG - Intergenic
1201542903 Y:15128136-15128158 TTACAAGGCATAACCTCATAAGG + Intergenic