ID: 1052845739

View in Genome Browser
Species Human (GRCh38)
Location 9:33334773-33334795
Sequence GGTCATGGTGAACTATGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052845739_1052845743 -4 Left 1052845739 9:33334773-33334795 CCTTGTCATAGTTCACCATGACC 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052845739 Original CRISPR GGTCATGGTGAACTATGACA AGG (reversed) Intronic
901770252 1:11526543-11526565 GGACAGGGTGAACTATGCCGAGG + Intronic
902876384 1:19343217-19343239 GGTCTTCGTGACCTGTGACAGGG - Intronic
906026691 1:42680297-42680319 GGAGATGGTGAAATATTACAAGG - Intergenic
907794110 1:57697379-57697401 TGACTTGGTGAACTATCACAAGG - Intronic
908018471 1:59873405-59873427 GGACATGGAGAACTATGCAAGGG + Exonic
908044114 1:60149828-60149850 AGACATGGTGAAATATGAAAGGG - Intergenic
909237031 1:73165951-73165973 GGTCATGGCAAAATATGGCATGG + Intergenic
911518818 1:98903898-98903920 GGTCATGGTGAAATGTGAACTGG - Intronic
914247695 1:145898008-145898030 GATCATGGTGAAATCTGACCTGG - Intronic
1063468447 10:6264052-6264074 GGTCTTTGTGAATGATGACAAGG + Intergenic
1063880652 10:10528348-10528370 GGTCATGGTGAAGAAGGCCAAGG - Intergenic
1065716084 10:28569902-28569924 GGTGCTGTTGAACTATGAAATGG - Intronic
1066440717 10:35436115-35436137 GGCCATGGGGAAGTGTGACATGG + Intronic
1067349172 10:45460250-45460272 GGTGAAGGTGAACATTGACAGGG - Intronic
1068900098 10:62258795-62258817 TGCCATGGTGAGCTATTACAGGG - Intronic
1073559093 10:104481754-104481776 GGAGATGGGGAACTAAGACAAGG - Intergenic
1079771231 11:24462155-24462177 GGTCATGCTGATACATGACATGG - Intergenic
1080723469 11:34871828-34871850 GGTCATGGAAAACTAGGACATGG - Intronic
1085513796 11:77100843-77100865 GGAGATGGAGAACTAAGACAAGG - Intronic
1085919082 11:80930190-80930212 GGTGATGGTGATGAATGACAGGG - Intergenic
1087736430 11:101839501-101839523 GTTCAGGGTGACCAATGACAAGG + Intronic
1089664304 11:120008167-120008189 AGTCATGGAGAAATATCACAGGG + Intergenic
1090916070 11:131163896-131163918 GGCCATGGAGAAATATGACAGGG - Intergenic
1095878303 12:47105553-47105575 GGTCATGGGGACCTATGAAAAGG + Intronic
1098847530 12:75556064-75556086 GGACATTGTGTACTTTGACAAGG + Intergenic
1100633975 12:96417004-96417026 GGTCAAGTTGAATTATGACTTGG - Intergenic
1103271395 12:119676640-119676662 GGTCATCCTGAACAAGGACACGG + Exonic
1104989270 12:132615899-132615921 CGTCATCGTGAAAAATGACAGGG + Intergenic
1105313040 13:19230247-19230269 TGTAATGGTGACCTATAACAAGG + Intergenic
1105364786 13:19754874-19754896 TGTAATGGTGACCTATAACAAGG + Intronic
1106774166 13:32992233-32992255 GGTTATAGTGAACTAGGACTGGG + Intergenic
1112019840 13:95362155-95362177 GGTCATGGAGAACGAGGACATGG - Intergenic
1112176743 13:97033295-97033317 AGTCATGGTGAAGGATGAAATGG - Intergenic
1112824658 13:103378258-103378280 GGTGATGGAGAACTATCACAGGG - Intergenic
1115932078 14:38508457-38508479 GGTCATGCTGATCTAAGAGATGG + Intergenic
1116134115 14:40898655-40898677 TGTTATTGTGAACTATGCCATGG + Intergenic
1117871592 14:60206787-60206809 GGTCATGGTCATCCATGACAAGG + Intergenic
1118969118 14:70617631-70617653 GATCATTGTAAACTATGCCAAGG + Intergenic
1123430583 15:20212255-20212277 GGCCATGGTGCACTATGATCAGG - Intergenic
1125994349 15:44143466-44143488 GGCCATGAAGAACTATGATATGG + Intronic
1131761205 15:95624431-95624453 GGCCCTGGTGAAAAATGACAGGG + Intergenic
1132024624 15:98394517-98394539 GGTCGTGGAAAACTAAGACACGG + Intergenic
1135094545 16:19554537-19554559 TGAGATGGTGACCTATGACAGGG - Intergenic
1135937437 16:26793176-26793198 GGCCAGGGTGGAATATGACAGGG - Intergenic
1136854052 16:33638962-33638984 GGCCATGGTGCACTATGATCAGG + Intergenic
1137664907 16:50244535-50244557 GGTCACGGTGACCTCTGCCAAGG - Intergenic
1138748463 16:59390990-59391012 GGCCATGGAAAACTAGGACATGG + Intergenic
1141047029 16:80724496-80724518 GGTCTTCATGAACTATGACAAGG - Intronic
1203115630 16_KI270728v1_random:1487401-1487423 GGCCATGGTGCACTATGATCAGG + Intergenic
1142683597 17:1563979-1564001 GTTCCTGGTGAACGATGATAAGG + Intergenic
1163039018 19:14588785-14588807 GGTCCTGGTGACCTTAGACAGGG + Intronic
1163432027 19:17273997-17274019 GGTGGTGGTGAACGATGACACGG + Exonic
1164282594 19:23781942-23781964 GGTCATTGTGACATATCACAGGG + Intronic
1166653399 19:44592369-44592391 GGCCATGGAGAACTGGGACACGG - Intergenic
1167023609 19:46897746-46897768 GGTCAAGGGGAGCTTTGACAAGG + Intergenic
928233318 2:29518840-29518862 GATCATGGTGAAATAGGAGAAGG + Intronic
928826016 2:35421915-35421937 GGAAAAGGAGAACTATGACATGG + Intergenic
930862231 2:56086928-56086950 TATAATGATGAACTATGACAAGG + Intergenic
932561418 2:72874449-72874471 GGTTACGGTGAGCTATGACTGGG - Intergenic
933974238 2:87495383-87495405 GGTCCTGGGGAACTGTGCCAAGG + Intergenic
937395273 2:121529839-121529861 GGTCAGGGTAAAATATGACTTGG + Intronic
937614747 2:123908337-123908359 GATCAAGGTAAACTATAACATGG + Intergenic
943436549 2:187870812-187870834 AGTCGTGGAGAACTATGATAGGG + Intergenic
1169012311 20:2260714-2260736 GGTTGTGGTGAACTATGATCAGG + Intergenic
1170300126 20:14874569-14874591 CATCATTGTGAACTATCACAAGG + Intronic
1172217081 20:33243314-33243336 AGTAATGGTGAAGGATGACAAGG - Intergenic
1174810715 20:53643261-53643283 GCTCAGGGTGATCTATCACACGG - Intergenic
1175384223 20:58583906-58583928 GCACATGTTGAACCATGACATGG - Intergenic
1175420256 20:58827630-58827652 GGTGATGGTGAAATAGAACAAGG + Intergenic
1178448723 21:32671242-32671264 GGTTATCGTGACCTATGATATGG + Intronic
1181522646 22:23458519-23458541 GTTTGTGTTGAACTATGACAAGG + Intergenic
952246320 3:31596467-31596489 GGCCATGGTGACCTGTGGCATGG + Intronic
956253985 3:67264258-67264280 GGCCATGGAGAACAAGGACACGG - Intergenic
957669341 3:83280743-83280765 GGTCATGCTGATTTAAGACATGG + Intergenic
957740098 3:84254672-84254694 GGCCATGGTTACCTATAACAAGG - Intergenic
959564853 3:107823994-107824016 AGTCATGGAGAAATATGATAGGG + Intergenic
960890485 3:122442976-122442998 GGGCAAGGTGAAGCATGACAGGG + Intronic
962501304 3:135996076-135996098 GGTCAGGCAGAACTGTGACATGG - Intronic
964288039 3:155142412-155142434 GGACATGGTGAACTTTGCAAAGG + Intronic
964341842 3:155716671-155716693 GGTCATGGGGAAGGATGACATGG - Intronic
966003806 3:174983335-174983357 GGTCCTGGTGATTTATGGCAGGG + Intronic
971091260 4:23348337-23348359 GGATATGGTGCACTATGATAAGG + Intergenic
973658002 4:53071140-53071162 TGTCATGCTGAACTATGAGAAGG + Intronic
979137565 4:117128380-117128402 GGTCATGGTGAAGCAAGAGATGG - Intergenic
988018511 5:25593120-25593142 GGTTATAGTGAACCATGTCACGG - Intergenic
991718495 5:69474077-69474099 AGACATGTTGAACTATGTCAAGG + Intergenic
992785060 5:80162434-80162456 GGTTATGGTGAGCTATGATCAGG - Intronic
993515633 5:88830514-88830536 GACCATGGATAACTATGACAGGG - Intronic
993625806 5:90223477-90223499 GGTCATAGATAACTATGGCAAGG - Intergenic
994903321 5:105803825-105803847 GATCAAGGTGAACTTTGAAATGG + Intergenic
996137721 5:119865343-119865365 AGTCATTGTGAAATATGACAAGG - Intergenic
997804915 5:136907377-136907399 GGTCAGGATAAATTATGACATGG - Intergenic
997842243 5:137252530-137252552 GTTCAGGCTGAAGTATGACAGGG - Intronic
999656397 5:153814945-153814967 GGTCATGATGAACGATGGCCAGG + Intergenic
1000979362 5:167799972-167799994 GGGGATGCTGAGCTATGACACGG - Intronic
1005017227 6:21385808-21385830 GGTCAGGGTGAATTTAGACATGG + Intergenic
1005026600 6:21468290-21468312 GGAGATGGTGAACTATGAGGTGG - Intergenic
1006637324 6:35469759-35469781 GGTGCTGGTGAACTATGATTTGG + Intronic
1008167924 6:48163531-48163553 GGTGATGGTGATGTATTACATGG - Intergenic
1010401724 6:75453747-75453769 GGTCACTGTGAACTATGAACAGG + Intronic
1013053798 6:106563437-106563459 GATCATGGTCACTTATGACAGGG + Intronic
1013702368 6:112788762-112788784 CAACATGGTGAGCTATGACAGGG + Intergenic
1015825976 6:137312388-137312410 AGTCATGAAGAAATATGACAGGG - Intergenic
1019162583 6:170079035-170079057 GGACATGGTGATCAAGGACATGG - Intergenic
1019588680 7:1818025-1818047 GTTTGTGTTGAACTATGACAAGG - Intronic
1024116669 7:46200678-46200700 GGCCATGGTGAACAAGTACATGG - Intergenic
1030124001 7:106137545-106137567 AGTCATGGAGAAATATGAGAGGG - Intergenic
1033852473 7:145514412-145514434 GGTCATTGTGAACTATTTTATGG + Intergenic
1036474732 8:9082846-9082868 GTTCAGGGTGAACTAAGACATGG + Intronic
1037795518 8:21990386-21990408 GTTCATGCTGAACAATCACACGG + Exonic
1040502862 8:48020666-48020688 GGTTATAGTGAGCTATGACCAGG - Intronic
1041209641 8:55535871-55535893 GGTCAAGGAGAACTATCACAGGG - Exonic
1041306124 8:56463109-56463131 GGTAATAGTGAACAATGTCAGGG - Intergenic
1041804071 8:61831141-61831163 GCACAAGATGAACTATGACACGG + Intergenic
1043640545 8:82444613-82444635 GTACATTGTGAACTATAACAAGG - Intergenic
1051821282 9:21172344-21172366 GCTCATTGTGAAATAGGACACGG + Intergenic
1052649509 9:31283130-31283152 AATAATGGTGAACTATAACAGGG + Intergenic
1052845739 9:33334773-33334795 GGTCATGGTGAACTATGACAAGG - Intronic
1059964521 9:119600747-119600769 GGTCAGGGACAACTATCACAGGG + Intergenic
1186872319 X:13785033-13785055 GGACATGGGGAGCTGTGACATGG - Intronic
1193186090 X:78514531-78514553 GTACATGGTGATCTATGAAAAGG + Intergenic
1194239928 X:91433409-91433431 GTTCTTGGTTAACTAAGACATGG - Intergenic