ID: 1052845739 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:33334773-33334795 |
| Sequence | GGTCATGGTGAACTATGACA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1052845739_1052845743 | -4 | Left | 1052845739 | 9:33334773-33334795 | CCTTGTCATAGTTCACCATGACC | No data | ||
| Right | 1052845743 | 9:33334792-33334814 | GACCCTTTTGGTGGTCATTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1052845739 | Original CRISPR | GGTCATGGTGAACTATGACA AGG (reversed) | Intronic | ||