ID: 1052845739

View in Genome Browser
Species Human (GRCh38)
Location 9:33334773-33334795
Sequence GGTCATGGTGAACTATGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052845739_1052845743 -4 Left 1052845739 9:33334773-33334795 CCTTGTCATAGTTCACCATGACC No data
Right 1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052845739 Original CRISPR GGTCATGGTGAACTATGACA AGG (reversed) Intronic