ID: 1052845743

View in Genome Browser
Species Human (GRCh38)
Location 9:33334792-33334814
Sequence GACCCTTTTGGTGGTCATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052845738_1052845743 11 Left 1052845738 9:33334758-33334780 CCATATGTGGATCTGCCTTGTCA 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG No data
1052845739_1052845743 -4 Left 1052845739 9:33334773-33334795 CCTTGTCATAGTTCACCATGACC 0: 1
1: 0
2: 0
3: 13
4: 108
Right 1052845743 9:33334792-33334814 GACCCTTTTGGTGGTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052845743 Original CRISPR GACCCTTTTGGTGGTCATTT AGG Intronic
No off target data available for this crispr