ID: 1052847865

View in Genome Browser
Species Human (GRCh38)
Location 9:33353260-33353282
Sequence CTGTGTCAATGACAAATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052847865_1052847871 11 Left 1052847865 9:33353260-33353282 CCTACCATTTGTCATTGACACAG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1052847871 9:33353294-33353316 CTCTGTGCTCCTCTGGTGTGAGG No data
1052847865_1052847872 12 Left 1052847865 9:33353260-33353282 CCTACCATTTGTCATTGACACAG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1052847872 9:33353295-33353317 TCTGTGCTCCTCTGGTGTGAGGG No data
1052847865_1052847870 4 Left 1052847865 9:33353260-33353282 CCTACCATTTGTCATTGACACAG 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1052847870 9:33353287-33353309 GGCTAAGCTCTGTGCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052847865 Original CRISPR CTGTGTCAATGACAAATGGT AGG (reversed) Intronic
902038869 1:13477817-13477839 CTGTGTCAAAAAGAAATGTTGGG + Intronic
902634363 1:17725560-17725582 CTGTCTCAAAAACAAAAGGTGGG - Intergenic
903479438 1:23642428-23642450 CTGTGTACCTGACACATGGTGGG + Intergenic
904731268 1:32593560-32593582 CTGTGACAATCTCAAATGTTTGG - Exonic
905009143 1:34735350-34735372 TTGTGTCAGTGACACATAGTGGG - Intronic
906024519 1:42661913-42661935 CAGTGACAGTGACAATTGGTTGG + Intronic
907113861 1:51951491-51951513 TAGTGACAATGACACATGGTGGG - Intronic
908427173 1:64018397-64018419 CTTTAACAATGACAAAAGGTTGG - Intronic
910687973 1:89937754-89937776 CTGTGTAAATGAATAATGGCAGG + Intergenic
911571743 1:99525789-99525811 CTGGGTCTATGAAAAATGCTGGG - Intergenic
912682044 1:111735369-111735391 ATGTGTGAAAGACAAATAGTTGG + Intronic
917172820 1:172196293-172196315 GCCTGTCAATGACAAATGATTGG - Intronic
917973635 1:180224825-180224847 CTGTGTCAAGGACACAGGGCAGG + Intergenic
918252910 1:182719723-182719745 CTATGTAAATGAAAAATAGTCGG - Intergenic
921097485 1:211899800-211899822 TTGTGTTAATGAAAAAAGGTGGG + Intergenic
922989620 1:229895359-229895381 CTGTGTCAAAAACAAATGGCAGG - Intergenic
923034904 1:230278986-230279008 CTGTGTTAATGACGAAGGGGTGG + Intronic
923386483 1:233470322-233470344 CTGTGTCCTCGACAAATGGCTGG - Intergenic
1064542701 10:16421004-16421026 CTCTGGAAATGAAAAATGGTGGG - Intergenic
1065679726 10:28216502-28216524 TAGTGTTAATGACAAATGATTGG - Intronic
1068019746 10:51566615-51566637 CTGTGTGAATGACAACTTCTCGG - Intronic
1068485251 10:57649942-57649964 CTGTTTCAGTGTCAAATAGTAGG + Intergenic
1071166609 10:82815348-82815370 CTATTTCTTTGACAAATGGTGGG - Intronic
1073580804 10:104663964-104663986 CCTTGTCCATGACAAATGCTTGG - Intronic
1074246276 10:111696912-111696934 GATTGTCAATGAAAAATGGTGGG - Intergenic
1074425383 10:113346750-113346772 CTTTGGCAATCACAAATGTTAGG + Intergenic
1075640219 10:124059389-124059411 CTGTGTCAAGGAAAAATTGTTGG - Intronic
1079139934 11:17801756-17801778 CCGTGTGAATAACAAATTGTAGG + Intronic
1080269059 11:30431439-30431461 CTATGGCAATGACACATTGTTGG + Intronic
1086654555 11:89337248-89337270 CTGTGAGAAGGACAAATGGAAGG + Intronic
1088943314 11:114482991-114483013 CTTTGTGAATGACAAACGCTAGG - Intergenic
1089011751 11:115137271-115137293 CTCAGTCAATACCAAATGGTTGG + Intergenic
1089205892 11:116762647-116762669 CTTTGGGAATGACAAATGGGAGG + Exonic
1089468578 11:118702772-118702794 CTATGTCAATTACAAATGAAAGG + Intergenic
1090152110 11:124395962-124395984 ATGTCTCCATTACAAATGGTAGG - Intergenic
1093006567 12:14057965-14057987 CTGTGTTACTGTCAAATGTTTGG - Intergenic
1093241026 12:16674724-16674746 CAGTGGCAAAGAGAAATGGTGGG + Intergenic
1093337854 12:17931276-17931298 TTTTGTTAATGACAAATGCTTGG + Intergenic
1093916097 12:24803818-24803840 CTCTGCCAATGACAGTTGGTTGG - Intergenic
1100796509 12:98187378-98187400 GTTTGTCAATTACAAATGGCTGG + Intergenic
1107083335 13:36398183-36398205 CTGAGCAAATGACAAATGGTAGG - Intergenic
1107821296 13:44288238-44288260 CTGTGTGTACGAGAAATGGTTGG - Intergenic
1109089099 13:58016412-58016434 CAGTTTCAATGACAATTGTTTGG - Intergenic
1109230479 13:59750659-59750681 CTGTGTGAATTACAATTGGTTGG + Intronic
1109442033 13:62387068-62387090 CTGAGTAAATGACAGATGTTGGG + Intergenic
1111791535 13:92862942-92862964 CTGTGTAAATGACAAAAAGAAGG + Intronic
1113185323 13:107680692-107680714 GTGTGTCCATGAGAAAGGGTGGG + Intronic
1116025899 14:39514279-39514301 TTGTGTCAATGTCCAAAGGTAGG + Intergenic
1121124019 14:91394376-91394398 CTGTGTCCCTGACACATGGCAGG - Intronic
1121445108 14:93973805-93973827 CTGTGCCAGTGACCAAAGGTGGG + Intronic
1121877372 14:97465635-97465657 CAGTGGCAATGACCAAGGGTTGG - Intergenic
1122381085 14:101307708-101307730 CTGTGTTAATGAAAAAGGGTTGG + Intergenic
1130078493 15:80710450-80710472 CTGTGTTAATGACAAATTGGAGG + Intronic
1130677358 15:85965163-85965185 CTGTATCAATGACAAATTTAAGG - Intergenic
1132269400 15:100510643-100510665 CTGGGTCAATGACATAGGGGTGG + Intronic
1135469474 16:22716577-22716599 CTATGTAAATGACAAACTGTGGG + Intergenic
1135812156 16:25597854-25597876 CTGTGTGAAAGACAAATTGTGGG - Intergenic
1137235416 16:46613014-46613036 CTGTGTAGAAAACAAATGGTGGG - Intronic
1139502090 16:67375183-67375205 GTGTAAGAATGACAAATGGTTGG + Intronic
1141650376 16:85389617-85389639 CTAGGACAGTGACAAATGGTGGG - Intergenic
1145207493 17:20992416-20992438 GTGTGTCCCTGACACATGGTGGG - Intergenic
1145246002 17:21269956-21269978 CTGTGGGAATGTGAAATGGTAGG - Intergenic
1148702398 17:49596944-49596966 CTTTGTCAAAGACAAATTCTGGG - Intergenic
1149564277 17:57630249-57630271 CTGTGGCCATGACAAACGGATGG - Intronic
1150628902 17:66862669-66862691 CTGCTTCAATGACCAATGCTGGG - Intronic
1153699302 18:7676558-7676580 GTTTGTCAAGGACAAATGTTTGG + Intronic
1157413217 18:47481245-47481267 CTGTCCCACTGACAAGTGGTGGG - Intergenic
1157720901 18:49923501-49923523 CTGTCTCCATGCAAAATGGTCGG - Intronic
1157979263 18:52362262-52362284 CTGTGGAAAGCACAAATGGTTGG - Intronic
1158807791 18:60995945-60995967 CTATTTCAATGAAAAATTGTGGG + Intergenic
1160234237 18:77073380-77073402 CTGGGTCAGAGACAAAGGGTGGG + Intronic
1161762196 19:6182344-6182366 CAGGTTCAATGACAAAGGGTTGG - Intronic
1163719988 19:18894355-18894377 CTGTCTCCATGACAACTGCTGGG - Intronic
1164139789 19:22448824-22448846 CTGCGTCAGTGGCAGATGGTAGG + Intronic
1164175855 19:22773763-22773785 CTGCCTCAATGGCAGATGGTAGG - Intronic
1164183551 19:22841015-22841037 GTGTGTCAATGGCAGATAGTAGG + Intergenic
1165968778 19:39607440-39607462 CTGTTTTAATGACAAAGTGTAGG - Exonic
924994723 2:348896-348918 CTGTTTCAAAGACACATGGGTGG - Intergenic
925545568 2:5012237-5012259 CTGTCTCAGTGACAAGTAGTAGG + Intergenic
926039308 2:9660097-9660119 GTGTGTTACTGACAAAGGGTGGG - Intergenic
930274120 2:49291851-49291873 ATGTGGCTAAGACAAATGGTTGG + Intergenic
933266438 2:80185737-80185759 CTGTGTCAAGTGAAAATGGTAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936659346 2:114524951-114524973 CTGAGACAATGACCAATGATTGG - Intronic
937517836 2:122675518-122675540 TTGTGCCTTTGACAAATGGTAGG + Intergenic
938707376 2:133944281-133944303 GTGTGTGAATGAGAAGTGGTTGG - Intergenic
939751842 2:146057702-146057724 CTGTGTTTTTGACAAATGCTTGG - Intergenic
945847939 2:214969814-214969836 TTGTGTCCATGACAAATGCTTGG + Intronic
945917952 2:215724310-215724332 ATGTGGCAATGACTAATGTTGGG - Intergenic
946430905 2:219627152-219627174 CTGTGTCAAGGTCAAACGTTGGG + Intergenic
1174067619 20:47876954-47876976 ATGAGTCAATGTCAAATGGTAGG - Intergenic
1174224973 20:48990629-48990651 CTGAGCCAATGTCACATGGTTGG - Intronic
1174286223 20:49475647-49475669 CTGTGTGAATGTGAAATGCTAGG - Intronic
1174984927 20:55440408-55440430 CTGTGTCAAATACAGCTGGTAGG + Intergenic
1175322322 20:58097900-58097922 ATGTGTCAATAACATATGGAGGG - Intergenic
1175457393 20:59125754-59125776 ACGAGTCAATGAAAAATGGTTGG - Intergenic
1176724558 21:10419957-10419979 CTGTGTCAAAGAAAAAAGGCCGG + Intergenic
1177804764 21:25863956-25863978 CAGTGTCAATGACTGATGGGTGG + Intergenic
1181765127 22:25085857-25085879 CTGTGTCCCTGACACATAGTAGG + Intronic
1183919563 22:41154151-41154173 CTATTTTAATGACAAATGTTAGG - Intronic
949972081 3:9416760-9416782 TTGTGTCTATGACATCTGGTGGG - Intronic
952153310 3:30616170-30616192 CTGAGTCTTTGACTAATGGTAGG + Intronic
952833400 3:37584426-37584448 TAGAGTCAATGACAAAGGGTAGG + Intronic
954764111 3:52898239-52898261 GAGTGTAAAAGACAAATGGTTGG + Intergenic
955290012 3:57683454-57683476 CTATGTCAATGACATAAAGTTGG - Intronic
956389569 3:68757053-68757075 CTGAGACAATGACCAATGGGAGG - Intronic
957419322 3:79948792-79948814 CATGGTCAATGAGAAATGGTAGG + Intergenic
958979888 3:100708947-100708969 CTGTGTAAAGGACAAAAGCTGGG - Intergenic
959943814 3:112106732-112106754 CTGTGGCAGTGACACATGGCAGG - Intronic
960310559 3:116111301-116111323 CACTGTCACTGAGAAATGGTAGG + Intronic
960626775 3:119688764-119688786 CTGTGTCAATGAGAACAGGTAGG - Intergenic
960865276 3:122193594-122193616 CTGTGTTACTGGCACATGGTAGG - Intronic
961481580 3:127184056-127184078 CTGTGTCACTGATCACTGGTGGG + Intergenic
962697536 3:137965174-137965196 GGGTGTCAATGGCAAATGGTGGG + Intergenic
962800905 3:138889721-138889743 CTGGGGCAATCACAATTGGTTGG - Intergenic
964166842 3:153717867-153717889 CTCTGTCAATGAAAATTGGAAGG + Intergenic
968686416 4:1962205-1962227 CTGTGTCAATCACAGGTCGTGGG + Intronic
970851610 4:20610418-20610440 TTGTGTCAATCACATATGCTAGG + Intronic
972812512 4:42606152-42606174 ATGTGTCAATTACAACGGGTTGG + Intronic
972815667 4:42642519-42642541 ATGTGTGAATGACAGCTGGTGGG + Intronic
973673467 4:53240381-53240403 CAGAATCAATGAAAAATGGTAGG + Intronic
975940489 4:79638644-79638666 CTGAATCAATGACAAAAGGCTGG - Intergenic
976224166 4:82782042-82782064 CTGAGCCACTGACAAATGGGCGG - Intronic
978905706 4:114003135-114003157 CTGTGTAAATGAGAAGAGGTAGG + Intergenic
983350409 4:166579845-166579867 CTGTGTCAAAGATGAATGTTGGG + Intergenic
983350438 4:166580811-166580833 CTGTGTCAAAGATGAATGTTGGG - Intergenic
984219213 4:176952895-176952917 CTATGTCAGTGGCAAATTGTAGG - Intergenic
987853788 5:23391365-23391387 CTGTGTTAATTACAAATTGGGGG + Intergenic
988670010 5:33371296-33371318 TTGTCCCAATGACCAATGGTTGG + Intergenic
988865800 5:35333230-35333252 CTGTGACAATGATAAATATTGGG + Intergenic
989641986 5:43591697-43591719 CTGTTTCACTGAGAAATGGAAGG + Intergenic
990077351 5:51865512-51865534 CTGTGTCCATGAGAAAGTGTAGG - Intergenic
993097522 5:83497027-83497049 GTGTGTGTATGAGAAATGGTGGG + Intronic
993529976 5:89012398-89012420 GTGTGTACATGACAAATGGTTGG - Intergenic
993850168 5:92998779-92998801 CTGTGTCCCTGACAAGTGCTGGG + Intergenic
996642315 5:125770798-125770820 CAGTGGCAATGAGAACTGGTGGG + Intergenic
1000180542 5:158806192-158806214 CTATGACAAAGACAAATGGAGGG + Intronic
1001490373 5:172150646-172150668 CTCTGTCAATGACCAAGGGCTGG + Intronic
1007996879 6:46317083-46317105 CTGAGTCAATGGAAAATGCTTGG + Intronic
1009951918 6:70407155-70407177 CTGGGTCAATGTCAATGGGTTGG - Intergenic
1011991861 6:93530839-93530861 CTGTGCAAATCACAAAAGGTTGG + Intergenic
1015300883 6:131651816-131651838 CTATGTAAATGAGAAATGCTGGG + Intronic
1015478859 6:133684886-133684908 CAGTGTCACTACCAAATGGTTGG + Intergenic
1017849376 6:158290816-158290838 CTGTGTCTATGACAAATGTGGGG - Intronic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1021638455 7:22714506-22714528 CTGTGTAAAAGAGAAAAGGTAGG + Intergenic
1022763035 7:33378150-33378172 CTGTGATAAAGACAAATGGGTGG - Intronic
1023896637 7:44439229-44439251 ATGTGTCCCTGACAAATTGTTGG - Intronic
1026954008 7:74365492-74365514 CTCTCTCAATGACAGCTGGTAGG - Intronic
1029389367 7:100264793-100264815 CCGTCTCAATGATAAATGGCAGG + Intronic
1029408827 7:100395713-100395735 GTGTGTAAATGACAAGTGTTGGG + Intronic
1029620102 7:101684951-101684973 CTGTATCACTTACAAATGGAGGG + Intergenic
1031625154 7:123984160-123984182 TTGATTCAATGACATATGGTTGG - Intergenic
1033028938 7:137806385-137806407 CAGTGTCAATGCCACATGATTGG + Intronic
1036697047 8:10982160-10982182 CTGTTTCAAAGGCAAATGGTAGG + Intronic
1037549024 8:19951710-19951732 ATGTATCTATGACAAGTGGTAGG + Intronic
1039789442 8:40863005-40863027 CTGTGCAAAGGACTAATGGTTGG + Intronic
1043187276 8:77170139-77170161 CAGTCTCAATGACAAAAGGTTGG - Intergenic
1047486031 8:125331471-125331493 CTGTGTAAATGTCAAGTGCTGGG + Intronic
1047735403 8:127760870-127760892 CTGTGCCACTGGCAAATAGTTGG - Intergenic
1048456226 8:134580756-134580778 CTGAGTCAATGATAACTGTTTGG + Intronic
1049147546 8:141012516-141012538 CAGTGTCAAGGACTACTGGTTGG + Intergenic
1052324568 9:27203639-27203661 CTTTATCAATCACAAATGGTGGG - Intronic
1052847865 9:33353260-33353282 CTGTGTCAATGACAAATGGTAGG - Intronic
1055916740 9:81409805-81409827 ATGTGTTAATCATAAATGGTAGG - Intergenic
1056872806 9:90300696-90300718 CTGGGTTAATGACAACTTGTGGG - Intergenic
1057942316 9:99296093-99296115 CAGTGTAAATGACCAATGGCAGG + Intergenic
1058575251 9:106394267-106394289 CAGTGTACATGGCAAATGGTAGG - Intergenic
1059070488 9:111130694-111130716 CTGTGCCGAAGACACATGGTGGG + Intergenic
1060028321 9:120191924-120191946 CTGTCTCCCTGACAAATGGGAGG + Intergenic
1186201480 X:7159315-7159337 CTGTGTCAATACCACAGGGTTGG - Intergenic
1186897527 X:14019164-14019186 CTGTGTCATTGGAAAATTGTAGG + Intronic
1189138610 X:38577348-38577370 CTGTGACCATGGCAGATGGTGGG - Intronic
1195000406 X:100637863-100637885 TTGTGTCAATGATGAAGGGTTGG - Intronic
1199096436 X:143746633-143746655 CTATCTCAATGACAATTAGTAGG + Intergenic
1200753632 Y:6969481-6969503 ATGTGGAAATGAAAAATGGTGGG + Intronic
1200928671 Y:8677280-8677302 CGGTGTCAGTGATAAATGGTTGG + Intergenic