ID: 1052853719

View in Genome Browser
Species Human (GRCh38)
Location 9:33393976-33393998
Sequence CTCTTTCTGTACACTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052853709_1052853719 30 Left 1052853709 9:33393923-33393945 CCTTTGCATGCCCTTCTTCATTC 0: 1
1: 1
2: 10
3: 36
4: 437
Right 1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 295
1052853712_1052853719 20 Left 1052853712 9:33393933-33393955 CCCTTCTTCATTCCTCAGGGCTC 0: 1
1: 8
2: 3
3: 32
4: 327
Right 1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 295
1052853714_1052853719 8 Left 1052853714 9:33393945-33393967 CCTCAGGGCTCTGTCCTCAACCC 0: 1
1: 10
2: 11
3: 62
4: 507
Right 1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 295
1052853713_1052853719 19 Left 1052853713 9:33393934-33393956 CCTTCTTCATTCCTCAGGGCTCT 0: 9
1: 0
2: 3
3: 35
4: 430
Right 1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 295
1052853715_1052853719 -6 Left 1052853715 9:33393959-33393981 CCTCAACCCATCCTTTTCTCTTT 0: 1
1: 8
2: 7
3: 74
4: 865
Right 1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG 0: 1
1: 0
2: 1
3: 25
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052853719 Original CRISPR CTCTTTCTGTACACTGTCTC TGG Intronic
900005933 1:51552-51574 CTCTTACTTCACACAGTCTCAGG - Intergenic
900800858 1:4736164-4736186 CTATTTCTGTCAACGGTCTCAGG - Intronic
902120396 1:14160093-14160115 GACCTTCTGTCCACTGTCTCTGG + Intergenic
902358676 1:15928635-15928657 CTCTCTCTCTCCACTCTCTCCGG - Exonic
902664915 1:17930755-17930777 CTATTTCTGTTCCCTGTCTCGGG + Intergenic
903295834 1:22342695-22342717 CTCTCTCTGTCCACTCCCTCTGG - Intergenic
904948226 1:34214796-34214818 CTCTTTGCCTCCACTGTCTCTGG - Intronic
905350841 1:37345340-37345362 CTCTTTCTGGAGTCTCTCTCTGG - Intergenic
906393982 1:45444539-45444561 GTCTTTCTGTACAGTGTGTGTGG - Intronic
909120983 1:71602671-71602693 CTCTTACTGTGCACTTTCACAGG + Intronic
909918431 1:81349796-81349818 CTATTTCTGTACTTTGCCTCTGG + Intronic
912548421 1:110467602-110467624 CTCATCCTGTAGACTGTCACTGG + Intergenic
914386499 1:147174153-147174175 TTCTTCCTGTAAACTGTCTTTGG - Intergenic
914883347 1:151564841-151564863 CAATTTCTGTACAGTGTTTCAGG - Intronic
915721487 1:157988953-157988975 CCCTTTCTCTCCTCTGTCTCTGG + Intergenic
916533509 1:165680864-165680886 CTCTTTCTGTTCCCAGTTTCGGG - Intronic
916539801 1:165742072-165742094 CTCCTTCTGAATACTGTCTGTGG - Intronic
917735992 1:177920945-177920967 ATGTTTCTGTTCCCTGTCTCAGG - Intergenic
918477785 1:184944004-184944026 CTGTTGCTGTACAATGTGTCAGG - Intronic
921238826 1:213155279-213155301 GTCCTCCTGTCCACTGTCTCTGG + Intronic
922186130 1:223276338-223276360 CTCTTTCTGTACAGGGGCTGTGG - Intronic
922220518 1:223554722-223554744 CCCTTACTGGACACTATCTCAGG + Intronic
922574128 1:226651122-226651144 CTCTTTCTCTCCACTGAGTCTGG - Intronic
922960310 1:229640730-229640752 CCCTTTCAGTAACCTGTCTCTGG + Intronic
923312691 1:232751075-232751097 GTCTTTCTGTAAACTGTTTCAGG - Intergenic
1063422801 10:5926985-5927007 CCATTTCCTTACACTGTCTCTGG - Intronic
1063665231 10:8056651-8056673 CTCTTGCCTTACTCTGTCTCTGG + Intronic
1065395422 10:25231621-25231643 CTCTGTCTGTACACGTTATCTGG + Intronic
1067804365 10:49382813-49382835 TTCTTCCTGGACACTGTCTAGGG + Intronic
1067804875 10:49385490-49385512 TTCTTCCTGGACACTGTCTAGGG + Intronic
1068092805 10:52453957-52453979 CTTGTTCTGTGCACTGTGTCGGG - Intergenic
1069089907 10:64187556-64187578 CTCTTTTTCTTCACAGTCTCGGG + Intergenic
1070533179 10:77355245-77355267 CTCTTTTTCTTCACAGTCTCAGG + Intronic
1071869825 10:89781495-89781517 CCCCTTCTGTCCAGTGTCTCTGG + Intergenic
1072488140 10:95875660-95875682 CTCTTTTTGTTCCCAGTCTCAGG - Exonic
1073823476 10:107291925-107291947 CTCTCCCTGTCCACTGGCTCTGG + Intergenic
1074022236 10:109596147-109596169 CTCTTTTTCTACCCAGTCTCAGG - Intergenic
1074930074 10:118115982-118116004 TTCTTTCTTTCCATTGTCTCTGG + Intergenic
1075543790 10:123338211-123338233 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1078191319 11:9094201-9094223 CTCTTTCTATACCCTCTCTCTGG + Intronic
1078581015 11:12539621-12539643 CTTTTTCAGTCCCCTGTCTCTGG - Intergenic
1079377345 11:19905473-19905495 CTCTTCCTGGACTCTGTCCCTGG - Intronic
1085282213 11:75338542-75338564 GTCTTTCTGTACACTGGGTCAGG + Intronic
1086309707 11:85522132-85522154 CTCTTGCTGTATACAGTCTCAGG + Intronic
1087265963 11:96061430-96061452 CTTTTTCTGAACAATGTCTCAGG + Intronic
1087876872 11:103369430-103369452 CCCTTCCAGTTCACTGTCTCTGG - Intronic
1088003382 11:104909815-104909837 CTCTTTCTTTACATAGTCTCAGG + Intergenic
1088006874 11:104951904-104951926 CTCTTTCTTTACATAGTCTCAGG + Exonic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1091418774 12:315984-316006 CTCACTCTGTACAGTCTCTCTGG - Intronic
1091858772 12:3760027-3760049 CTCTTTCTTTCCCCAGTCTCGGG + Intronic
1092126631 12:6079295-6079317 CTGTTTCTGTGTCCTGTCTCAGG - Intronic
1092520877 12:9271519-9271541 CTATTTCTGTACTCTATCTGAGG - Intergenic
1093628928 12:21385616-21385638 CTATTACCGTACAATGTCTCTGG + Intronic
1094385924 12:29893656-29893678 CTCTTTCTGCACATTGTATATGG + Intergenic
1095135758 12:38600379-38600401 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1095968899 12:47888015-47888037 CTCTTTCTCTTCCCAGTCTCAGG - Intronic
1097464721 12:59908211-59908233 CTCTATTTGTACTCTGGCTCTGG + Intergenic
1099407781 12:82284477-82284499 CTCTTTTTGTTCCCTGTTTCAGG + Intronic
1101105134 12:101433091-101433113 CTATTTCTGTGCTCTGCCTCTGG + Intergenic
1102140644 12:110612264-110612286 ATATTTTTATACACTGTCTCTGG + Intergenic
1102148878 12:110674784-110674806 CTCTTTTTCTTCCCTGTCTCAGG + Intronic
1102317856 12:111904589-111904611 CTCACTCAGTCCACTGTCTCAGG - Intergenic
1102453168 12:113056401-113056423 ATCTTTCTTTAGACAGTCTCTGG + Intergenic
1104760190 12:131293552-131293574 CTCTTTCTGGGCACTTTCTCAGG - Intergenic
1104819581 12:131667094-131667116 CTCTTTCTGGGCACTTTCTCAGG + Intergenic
1106367880 13:29100929-29100951 CTCTGGCTGTGCACTGTCCCCGG - Exonic
1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG + Intronic
1107838270 13:44429834-44429856 CTCATTCACTACACTATCTCTGG + Intergenic
1108708949 13:53014937-53014959 CTATGTCTGTCCACAGTCTCTGG - Intergenic
1109016407 13:57020810-57020832 CCCTCTCAGTTCACTGTCTCTGG - Intergenic
1112552984 13:100439153-100439175 CTCTATCTGTAAACACTCTCTGG - Intronic
1114866604 14:26602069-26602091 CTTTTTCTGAGCACTTTCTCTGG + Intergenic
1115640507 14:35332792-35332814 CTCTTGAAGTACACTTTCTCAGG - Intergenic
1116079335 14:40153889-40153911 CCCTTTATGTCCACTGGCTCTGG - Intergenic
1116351358 14:43867852-43867874 CTCTCTCTCTACTCTCTCTCTGG + Intergenic
1118668578 14:68098446-68098468 CTCTTTTTCTACCCAGTCTCAGG - Intronic
1120104780 14:80481161-80481183 CTCTTTTTCTTCCCTGTCTCGGG - Intronic
1121483669 14:94297352-94297374 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1122182824 14:99968264-99968286 CTCCTTCTCTACACTGTTTCGGG - Intergenic
1125225775 15:37394513-37394535 ATCTTTCTGTGACCTGTCTCAGG - Intergenic
1126186941 15:45840082-45840104 TTCTTTGTGTGCAGTGTCTCAGG + Intergenic
1127576386 15:60296160-60296182 CTCTTTTTCTTCCCTGTCTCGGG - Intergenic
1127601309 15:60539963-60539985 CTCTTTCTCTAGAATCTCTCGGG + Intronic
1127642229 15:60926871-60926893 CTCTCTCTGTACAGTCTATCTGG - Intronic
1127837009 15:62798050-62798072 CTCTTTCTTAACTCTGTCTCTGG - Intronic
1128931201 15:71706325-71706347 CTCCTCCTGTTCACTGGCTCAGG - Intronic
1129664377 15:77571447-77571469 CTCTAACTGCCCACTGTCTCCGG + Intergenic
1130977964 15:88791834-88791856 CTCTTTGTGTGCCCTGTGTCTGG - Intergenic
1131473916 15:92719949-92719971 CTCTTTCTGTTCTCTGTTCCTGG - Intronic
1132331621 15:101015943-101015965 CTCTCTCTCTTCACTATCTCAGG - Intronic
1132447583 15:101939371-101939393 CTCTTACTTCACACAGTCTCAGG + Intergenic
1133378898 16:5313541-5313563 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1133604451 16:7372479-7372501 CTCTTTCTGTACATGGCCACAGG - Intronic
1134795942 16:17037021-17037043 CTCTTTCATAACCCTGTCTCAGG - Intergenic
1135794357 16:25426933-25426955 CTTTTTCTGCCCACTGTCTTTGG + Intergenic
1135968706 16:27056433-27056455 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1138092896 16:54191078-54191100 CTCTTTCTGTAAAGTGCTTCTGG - Intergenic
1138876124 16:60952351-60952373 CGCATTCTGAACACTGTCTCAGG + Intergenic
1141914929 16:87089162-87089184 CGCTTTGGGTACACTTTCTCAGG + Intronic
1142772330 17:2107523-2107545 GCCTTTCTGCTCACTGTCTCTGG + Intronic
1143117118 17:4587345-4587367 CTCTTGCTGTCCTCCGTCTCAGG + Intronic
1144028823 17:11301879-11301901 CTCTTTCTCTTCCCAGTCTCTGG - Intronic
1147027325 17:37598567-37598589 CTCTTTCTCTCCTCTGTCTCCGG + Intronic
1150049551 17:61947891-61947913 CTCATTCTGTACACTGTATAAGG + Intronic
1151057404 17:71049268-71049290 CTCTGTGTGTACCCTGTCACTGG - Intergenic
1151421948 17:74004610-74004632 CGCTTTCTCTACACTTTGTCAGG - Intergenic
1151874776 17:76861353-76861375 TTCTTTCTGAACAGTTTCTCTGG - Intergenic
1152272425 17:79332462-79332484 CTCTTTTTGTTCATTGACTCAGG - Intronic
1153012106 18:548562-548584 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1155020440 18:21892055-21892077 CTGTTTCTCTATACTGTCACAGG + Intergenic
1155146877 18:23091558-23091580 TTCTCTCTCTTCACTGTCTCTGG + Intergenic
1156611281 18:38727794-38727816 CTCATTCTGTACTCTAACTCTGG - Intergenic
1156762285 18:40607388-40607410 CTCTTTCTATATATTGTGTCAGG + Intergenic
1157506827 18:48232196-48232218 CTCTATCTTCACATTGTCTCAGG - Intronic
1158391408 18:57048450-57048472 CTCTCCCTGTTCACTGTCTGAGG - Intergenic
1159263972 18:66055323-66055345 CTCTTTTTGGACACTGTCTCTGG + Intergenic
1159306039 18:66643654-66643676 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1160637689 19:93158-93180 CTCTTACTTCACACAGTCTCAGG - Intergenic
1160656575 19:275095-275117 CTCTTTCTGGACACTCTCCATGG + Intergenic
1161934448 19:7362992-7363014 CACTTTGTGTACATTATCTCAGG + Intronic
1162852368 19:13440691-13440713 CTCTTTCTTCAGACTGTCCCTGG + Intronic
1162955037 19:14092749-14092771 CTCTTTCCATACCCTGTCCCTGG + Exonic
1163241167 19:16064736-16064758 CTCATTCTCTTCACTATCTCAGG - Intergenic
1163425943 19:17241070-17241092 CTCTGGCTGTACCCTCTCTCTGG - Intronic
1163716073 19:18873010-18873032 CTCTCTCTGCACACTCGCTCTGG - Intronic
1164214327 19:23130381-23130403 CTCTTTCTCTTCCCAGTCTCAGG + Intronic
925013924 2:507594-507616 CTCCTTCTGTTCTCTGTTTCTGG - Intergenic
925071899 2:976381-976403 CTCTATGTGTACATTGTCTTTGG + Intronic
925271869 2:2615717-2615739 CTCTTTCTGCAGTGTGTCTCTGG + Intergenic
925537506 2:4933268-4933290 CTCTTTTTGTTCCCAGTCTCAGG + Intergenic
925805742 2:7646027-7646049 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
928259677 2:29755456-29755478 CTATTTCTGCAGACTATCTCAGG + Intronic
928876924 2:36050986-36051008 ATCATTCTGTACATTGGCTCTGG - Intergenic
929288732 2:40165263-40165285 CTCTGCCTGTACATTGTCTATGG + Intronic
930835181 2:55785289-55785311 CTCAGTCTGTAGACTTTCTCTGG + Intergenic
931260343 2:60612633-60612655 TTCTTACTGTATACTCTCTCTGG - Intergenic
931922501 2:67036677-67036699 CTCTGTCTTTACATTGACTCAGG - Intergenic
932071397 2:68624221-68624243 TTCTTTTTGTACAGAGTCTCAGG + Intronic
932606961 2:73171932-73171954 TTCTTTCTGAACACTCTTTCTGG + Intergenic
933925466 2:87088479-87088501 TTCTTTCTGAACACTCTTTCTGG - Intergenic
933950171 2:87322501-87322523 CTATTTCTATCCACTTTCTCTGG + Intergenic
935188238 2:100753673-100753695 CTCCTTCTGTGCTCAGTCTCAGG - Intergenic
936039302 2:109137655-109137677 CTCTTTCTCTCCAGTATCTCTGG - Intronic
936145780 2:109979983-109980005 CTCTCTCTGAACCCTGGCTCTGG + Intergenic
936198909 2:110391495-110391517 CTCTCTCTGAACCCTGGCTCTGG - Intergenic
936330017 2:111539096-111539118 CTATTTCTATCCACTTTCTCTGG - Intergenic
937344987 2:121119889-121119911 CTCTGTCTTTCCACTGTGTCTGG - Intergenic
939278375 2:140030979-140031001 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
939930847 2:148231077-148231099 CTCCTCCAGTCCACTGTCTCTGG + Intronic
940078096 2:149766628-149766650 CTCTGCCTGAAAACTGTCTCTGG + Intergenic
941539046 2:166759317-166759339 CTCTTTCTCTAAACTATTTCTGG - Intergenic
941545927 2:166851484-166851506 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
943072320 2:183154846-183154868 CTCTTTTTCTTCCCTGTCTCAGG - Intronic
943462706 2:188189357-188189379 CTCTTGCAGTACACTTTCTTAGG + Intergenic
944190769 2:197001158-197001180 CTTTGTCTTTACATTGTCTCTGG - Intronic
945326587 2:208489220-208489242 CTTTTTCTCTGCACTCTCTCTGG + Intronic
947061064 2:226166430-226166452 GTCTTTCTGGACATTGTCTAAGG - Intergenic
947357449 2:229311719-229311741 CTCATTCTCAACACTGTTTCGGG + Intergenic
947453779 2:230234225-230234247 CTCATCCTGGACTCTGTCTCTGG + Intronic
1171449477 20:25225704-25225726 CACTTTCTGCACACTGGCTCTGG + Exonic
1171525253 20:25804070-25804092 CTCTTTTTCTTCCCTGTCTCGGG + Intronic
1171551574 20:26051814-26051836 CTCTTTTTCTTCCCTGTCTCGGG - Intergenic
1171792696 20:29543113-29543135 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
1171806619 20:29687063-29687085 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
1171837428 20:30169448-30169470 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1171855773 20:30341289-30341311 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1174167602 20:48596231-48596253 TTCTTTCTCTACTCTGTCTGGGG - Intergenic
1174865888 20:54135373-54135395 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1177117401 21:17102863-17102885 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1177224646 21:18238269-18238291 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1177426523 21:20930192-20930214 CTTTTTTTATAGACTGTCTCAGG + Intergenic
1179101733 21:38360427-38360449 CTCTTTCTACACCCTCTCTCTGG - Intergenic
1180245391 21:46543942-46543964 CTCTTTCTTTTTACTGTCTTTGG + Intronic
1180573822 22:16753646-16753668 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1180623848 22:17180793-17180815 CTCTCTCTGTACACTTTTCCTGG - Exonic
1182761868 22:32728899-32728921 CTCCTTCTGAAGACTTTCTCTGG - Intronic
1184506350 22:44906173-44906195 CTCTCTCTCTCCACTGTATCTGG + Intronic
950263522 3:11559036-11559058 CTCTTTCTGAACTCGGACTCTGG - Intronic
951348628 3:21577621-21577643 CTCTTTCTATACACTGTTGGTGG - Intronic
952499365 3:33945521-33945543 CCCTCTGAGTACACTGTCTCTGG + Intergenic
953709507 3:45258272-45258294 CTACTTCTGTACACTGTCCATGG + Intergenic
955538066 3:59945593-59945615 ACCATTCTGTACACGGTCTCTGG - Intronic
956476035 3:69621350-69621372 CCCTGTCAGTCCACTGTCTCTGG - Intergenic
956643924 3:71438182-71438204 CTCTTTAAGAACACTGTGTCTGG + Intronic
960173207 3:114487442-114487464 TCCTTTCTGGACACTGTCTAAGG + Intronic
960372031 3:116852531-116852553 CTCTTTCCCCACACTGTCTCTGG + Intronic
962205300 3:133429276-133429298 CTCTCTCTGTACACATTCTATGG - Intronic
962581341 3:136800587-136800609 CCCTTTCTATACCCTCTCTCTGG - Intergenic
963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG + Intronic
964047670 3:152350043-152350065 TTCTTACTGTACATTCTCTCTGG - Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG + Intronic
965045379 3:163571503-163571525 CTCTTTTTCTTCACAGTCTCTGG + Intergenic
966716976 3:183022340-183022362 CTCTTTCAGTGGAATGTCTCTGG + Intronic
967044917 3:185727529-185727551 CTCTTCCTCTTCACTGTTTCTGG - Intronic
967246119 3:187488237-187488259 CTCTTTTTGTTCACAGTTTCAGG + Intergenic
967350292 3:188507282-188507304 CTGCTTCTGTATACTGACTCAGG + Intronic
970398908 4:15699536-15699558 CTCTTTCTGTTCCCAGTTTCAGG - Intronic
970667553 4:18354602-18354624 CTCCTCCAGTCCACTGTCTCTGG + Intergenic
970719848 4:18973630-18973652 TTCTTGCTGTTCATTGTCTCTGG - Intergenic
970900759 4:21156455-21156477 CTCTTTCCGTGCATTGACTCTGG - Intronic
971136954 4:23879383-23879405 CTCTATCTTTCCACTGCCTCAGG - Intronic
971847103 4:31933026-31933048 CTCTGGCTCTACATTGTCTCTGG - Intergenic
971860177 4:32091428-32091450 ATCTTTCTGTACTTTCTCTCTGG - Intergenic
972259972 4:37397847-37397869 TTCTCTCTGTCCACTGCCTCTGG + Intronic
973277627 4:48326772-48326794 TTCTTTCAGTTCACTCTCTCAGG - Intergenic
973530419 4:51832249-51832271 CTATTTCTATACGCAGTCTCGGG - Intergenic
973636792 4:52868497-52868519 CCCATTCTGTCCACTCTCTCAGG + Intergenic
974794833 4:66735216-66735238 TTCTTTCTGTACATTTTCTGTGG + Intergenic
975252637 4:72197770-72197792 CCCTCTCAGTCCACTGTCTCTGG - Intergenic
976405399 4:84656787-84656809 CTCTTTTTCTTCACAGTCTCGGG - Intergenic
978616117 4:110598004-110598026 TTCTTTTTGATCACTGTCTCTGG - Intergenic
978662009 4:111137924-111137946 CTCCCTCAGTCCACTGTCTCTGG + Intergenic
978970435 4:114797420-114797442 CTCTTTCTGTGCAGTGTCTGTGG - Intergenic
980136516 4:128863400-128863422 GTCTTTCCCTACACTGTTTCAGG - Intronic
981875151 4:149533530-149533552 TTCTTTATGTACCCAGTCTCGGG - Intergenic
981966437 4:150609432-150609454 CTCTTTCAGTTCTCTGTCCCCGG - Intronic
984661116 4:182376684-182376706 TGGTTTCTGTACACTGACTCCGG - Intronic
984922675 4:184779421-184779443 CTCTTTTTGTTCCCAGTCTCAGG + Intronic
986966957 5:13285162-13285184 TTATTTCTGGACACTGTCTTTGG + Intergenic
988683638 5:33506810-33506832 CTCTTTTTCTTCCCTGTCTCAGG - Intergenic
988931136 5:36036542-36036564 CTATTTATGTACAATGTCTGAGG + Intronic
990237569 5:53784262-53784284 CTCTTTCCACACACTGTGTCAGG + Intergenic
990264461 5:54060608-54060630 CTCTTTTTCTACCCAGTCTCAGG + Intronic
991092783 5:62709187-62709209 CTGTTGCTGAATACTGTCTCTGG - Intergenic
991273260 5:64812053-64812075 CTCTTACTGTACTTTGTGTCTGG + Intronic
992665377 5:79003435-79003457 CTCTTTCTGTTCTGTATCTCTGG - Intronic
992733769 5:79698555-79698577 CTCTTGCTGTCTGCTGTCTCTGG + Intronic
992895058 5:81238703-81238725 CACATTCTGTCCACTGTATCTGG + Intronic
993767645 5:91880800-91880822 TTCTTTCTGTATACTGTTGCTGG + Intergenic
993927292 5:93883742-93883764 GGCATTCAGTACACTGTCTCTGG + Intronic
993971943 5:94430161-94430183 CTCTTTCTGTACAGAGATTCTGG - Intronic
995584936 5:113638875-113638897 CTCTGCCTGTACACTCTCTGGGG + Intergenic
995631022 5:114132772-114132794 TTCTTTCTGTATACTGTATTAGG + Intergenic
995823175 5:116261797-116261819 CTGTCTCTGTTCTCTGTCTCTGG + Intronic
995969731 5:117953515-117953537 CTCTTTCTGTTCTCAGTTTCGGG + Intergenic
996587296 5:125104001-125104023 CTCTTTCTGGGCACTCTCTCTGG - Intergenic
996990495 5:129624500-129624522 CTCTTTGTGGTCACTGTCACTGG + Intronic
997812109 5:136980674-136980696 CTTTTTCTTTACCCAGTCTCAGG + Intronic
999394259 5:151216822-151216844 CTCTGTCTGTACCTTGACTCTGG - Intronic
1000454852 5:161437107-161437129 CTCTCTCAGTCCACTGTCTCTGG - Intronic
1000512295 5:162198427-162198449 CTCTCTCTCAATACTGTCTCTGG - Intergenic
1002910885 6:1490150-1490172 CTCTGTCAGCACACAGTCTCTGG + Intergenic
1003686354 6:8307105-8307127 CTATTTCTGTAGAGTGTCACTGG + Intergenic
1005426863 6:25711955-25711977 CTCTTTCACCACACTGTGTCAGG - Intergenic
1006457788 6:34141923-34141945 CTCTCTCTGTGTACTCTCTCTGG - Intronic
1009704321 6:67225992-67226014 CTGTTTCTATACACTGTTTTAGG + Intergenic
1010108211 6:72192449-72192471 CTGGGTCTGTAAACTGTCTCAGG + Intronic
1011149346 6:84252963-84252985 TTCTGTCTTGACACTGTCTCTGG - Intergenic
1011495972 6:87936952-87936974 CTCTTTTTGTTCCCTGTCTTGGG - Intergenic
1012678856 6:102153609-102153631 CTCTCTCAGTCCACTGTCTCTGG - Intergenic
1015249131 6:131108241-131108263 CTCTTTCTGTTCCCAGTTTCAGG - Intergenic
1015333716 6:132010610-132010632 CTCCATCTGTCCACTGGCTCAGG - Intergenic
1016555322 6:145329820-145329842 CTCTTTTTGTACTCTGATTCAGG - Intergenic
1016792091 6:148076731-148076753 CACTTTCCGTACCCCGTCTCAGG - Intergenic
1017152299 6:151291386-151291408 CTCTTTCTGTTGACTGTCCTGGG + Intronic
1017654239 6:156612329-156612351 CTCTTTCTATATTCTTTCTCTGG - Intergenic
1021203660 7:17753733-17753755 ACCTTTCTGTCCACTGGCTCTGG + Intergenic
1021758177 7:23876219-23876241 CTCTTGCTATACATTTTCTCTGG - Intergenic
1021808910 7:24383683-24383705 CTCTTGTTGTACAGTGTTTCAGG + Intergenic
1022613170 7:31897646-31897668 CTCTCTCTGGACACTCTCTGAGG + Intronic
1023095191 7:36653309-36653331 CTCTTTTAGTAGACTGTCTCAGG - Intronic
1025285936 7:57660677-57660699 CTCTTTTTCTTCCCTGTCTCAGG + Intergenic
1026740816 7:72977146-72977168 CAGTTTCTGGACACTGTCGCAGG - Intergenic
1027102917 7:75387928-75387950 CAGTTTCTGGACACTGTCGCAGG + Intergenic
1027492133 7:78841456-78841478 CTCAGTCTGCACACTGTTTCTGG + Intronic
1029105379 7:98170971-98170993 TTCTTTCTCTTCACCGTCTCAGG + Intronic
1031097681 7:117441068-117441090 CTCTTTTTCTGCCCTGTCTCAGG - Intergenic
1031681289 7:124678126-124678148 CTTTTTCTGTTCTTTGTCTCAGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1034917703 7:155054544-155054566 CTGTTTCTGTTCACTTTCCCAGG + Intergenic
1036577553 8:10042219-10042241 CTCTTTGTGTGCACTGGCGCTGG + Intergenic
1037927677 8:22857301-22857323 CTTTCTCTGTAAACTGCCTCAGG - Intronic
1039813006 8:41066600-41066622 CTCTCTCTGTACTCTCTTTCTGG - Intergenic
1040639874 8:49320875-49320897 GTCTTTGTTTACACTGTTTCTGG + Intergenic
1041919507 8:63166605-63166627 CTCTTTCTCTTCTCAGTCTCGGG + Intergenic
1042324684 8:67516371-67516393 TTCTTTCTGCACATTCTCTCTGG + Intronic
1042338561 8:67654812-67654834 CTCTTTTTCTACACTGCCCCAGG + Intronic
1042592267 8:70407866-70407888 GTCATACTGTACACTGTCACAGG + Intergenic
1042744780 8:72096109-72096131 TCCTTTCTGTGCTCTGTCTCTGG - Intronic
1043775441 8:84261561-84261583 CTCTTTCCTTACCCAGTCTCAGG + Intronic
1044049045 8:87476655-87476677 CTTTTTGTGAACATTGTCTCAGG + Intronic
1044926204 8:97210647-97210669 CTTTTTATTTTCACTGTCTCTGG - Intergenic
1046454421 8:114440078-114440100 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1047042298 8:121009397-121009419 CTCTTTTTGTAAAATGACTCTGG - Intergenic
1047397909 8:124519394-124519416 CTTTTTCTGTAGTCAGTCTCTGG - Intronic
1049705242 8:144039216-144039238 CTTTTTCTGGCCACTGTTTCGGG - Intronic
1050682920 9:8134895-8134917 GTCTTTCAGTGGACTGTCTCAGG + Intergenic
1052252377 9:26413633-26413655 CTGTTTCAGTACACTGCCACGGG - Intergenic
1052396391 9:27943825-27943847 CTCCTTCTGTGGGCTGTCTCAGG + Intergenic
1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG + Intronic
1053877525 9:42559235-42559257 CTCCTTCTGTCCATTGTTTCTGG + Intergenic
1053895128 9:42735442-42735464 CTCCTTCTGTCCATTGTTTCTGG - Intergenic
1054234169 9:62542487-62542509 CTCCTTCTGTCCATTGTTTCTGG - Intergenic
1054936780 9:70696567-70696589 TTCTTTCTTTACCCTGTCTCAGG - Intronic
1056231501 9:84550124-84550146 CTCTCTCGGTGCACTTTCTCTGG + Intergenic
1056670289 9:88622147-88622169 CTCTTTCTGATCACTTGCTCTGG + Intergenic
1057052328 9:91935329-91935351 CTTTTTCTGTCCACTGCTTCAGG + Intronic
1058401689 9:104626297-104626319 CTCTTTTTCTTCACAGTCTCAGG + Intergenic
1059701848 9:116782633-116782655 CACTTTCTGAACACTGACTTGGG + Intronic
1060941676 9:127546189-127546211 CTTTTTCTCCACAATGTCTCTGG + Intronic
1186398774 X:9237273-9237295 CTCTTTCTCTGCGCTGTCTCTGG - Intergenic
1188550033 X:31353396-31353418 CTCTTTCTGATCTCAGTCTCAGG - Intronic
1190691629 X:52917565-52917587 CTCTTTCTGTGCTCTGTTTGGGG + Intergenic
1190694354 X:52938227-52938249 CTCTTTCTGTGCTCTGTTTGGGG - Intronic
1191229713 X:58084410-58084432 CTCTTTCTTTAGAATGTCTGAGG + Intergenic
1191233744 X:58117843-58117865 CTCTTTCTGTAGAATGCCTGGGG - Intergenic
1191856289 X:65629546-65629568 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1194141374 X:90214208-90214230 CTCTTTCTTTTCTCAGTCTCTGG + Intergenic
1194171487 X:90589151-90589173 CTGTTCCTGTACATTTTCTCTGG + Intergenic
1194553589 X:95331058-95331080 CCCTTTCAGTCCACTGTCTCTGG + Intergenic
1195272559 X:103246379-103246401 CTCTTTCTGAACACTTGTTCTGG + Intergenic
1195880598 X:109588893-109588915 CTCTTTCTATTCCCAGTCTCAGG + Intergenic
1198569051 X:137935527-137935549 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1198818150 X:140614873-140614895 CTCTGCCAGTCCACTGTCTCAGG + Intergenic
1199115286 X:143985115-143985137 CCCCTTCAGTCCACTGTCTCTGG + Intergenic
1199425584 X:147697467-147697489 GTCTTTCTGAACATGGTCTCTGG + Intergenic
1200285645 X:154819819-154819841 CACTTTCTGTAAACTGTCCTCGG + Intronic
1200517718 Y:4166905-4166927 CTGTTCCTGTACATTTTCTCTGG + Intergenic
1201511752 Y:14771613-14771635 CTGTTTCTTCACAGTGTCTCAGG - Intronic
1202058503 Y:20861326-20861348 CACTTTCTGCATAGTGTCTCAGG - Intergenic