ID: 1052857754

View in Genome Browser
Species Human (GRCh38)
Location 9:33417632-33417654
Sequence CAGAGGTGAGAGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052857754_1052857765 23 Left 1052857754 9:33417632-33417654 CCTCCTGCCCTCTCTCACCTCTG No data
Right 1052857765 9:33417678-33417700 CCAAGTCTGGGAACTCCCTGAGG No data
1052857754_1052857766 30 Left 1052857754 9:33417632-33417654 CCTCCTGCCCTCTCTCACCTCTG No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data
1052857754_1052857760 10 Left 1052857754 9:33417632-33417654 CCTCCTGCCCTCTCTCACCTCTG No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857754_1052857761 11 Left 1052857754 9:33417632-33417654 CCTCCTGCCCTCTCTCACCTCTG No data
Right 1052857761 9:33417666-33417688 AGAAGTCTGTCCCCAAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052857754 Original CRISPR CAGAGGTGAGAGAGGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr