ID: 1052857760

View in Genome Browser
Species Human (GRCh38)
Location 9:33417665-33417687
Sequence CAGAAGTCTGTCCCCAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052857754_1052857760 10 Left 1052857754 9:33417632-33417654 CCTCCTGCCCTCTCTCACCTCTG No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857752_1052857760 12 Left 1052857752 9:33417630-33417652 CCCCTCCTGCCCTCTCTCACCTC No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857750_1052857760 28 Left 1052857750 9:33417614-33417636 CCCAGACGGGCTCTGTCCCCTCC No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857756_1052857760 3 Left 1052857756 9:33417639-33417661 CCCTCTCTCACCTCTGTATTCCT No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857751_1052857760 27 Left 1052857751 9:33417615-33417637 CCAGACGGGCTCTGTCCCCTCCT No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857758_1052857760 -7 Left 1052857758 9:33417649-33417671 CCTCTGTATTCCTGCTCAGAAGT No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857755_1052857760 7 Left 1052857755 9:33417635-33417657 CCTGCCCTCTCTCACCTCTGTAT No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857757_1052857760 2 Left 1052857757 9:33417640-33417662 CCTCTCTCACCTCTGTATTCCTG No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data
1052857753_1052857760 11 Left 1052857753 9:33417631-33417653 CCCTCCTGCCCTCTCTCACCTCT No data
Right 1052857760 9:33417665-33417687 CAGAAGTCTGTCCCCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052857760 Original CRISPR CAGAAGTCTGTCCCCAAGTC TGG Intergenic
No off target data available for this crispr