ID: 1052857766

View in Genome Browser
Species Human (GRCh38)
Location 9:33417685-33417707
Sequence TGGGAACTCCCTGAGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052857759_1052857766 3 Left 1052857759 9:33417659-33417681 CCTGCTCAGAAGTCTGTCCCCAA No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data
1052857754_1052857766 30 Left 1052857754 9:33417632-33417654 CCTCCTGCCCTCTCTCACCTCTG No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data
1052857756_1052857766 23 Left 1052857756 9:33417639-33417661 CCCTCTCTCACCTCTGTATTCCT No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data
1052857758_1052857766 13 Left 1052857758 9:33417649-33417671 CCTCTGTATTCCTGCTCAGAAGT No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data
1052857757_1052857766 22 Left 1052857757 9:33417640-33417662 CCTCTCTCACCTCTGTATTCCTG No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data
1052857755_1052857766 27 Left 1052857755 9:33417635-33417657 CCTGCCCTCTCTCACCTCTGTAT No data
Right 1052857766 9:33417685-33417707 TGGGAACTCCCTGAGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052857766 Original CRISPR TGGGAACTCCCTGAGGACAG AGG Intergenic
No off target data available for this crispr