ID: 1052862747

View in Genome Browser
Species Human (GRCh38)
Location 9:33447037-33447059
Sequence AGCCCCCAGATGTAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 229}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052862747_1052862767 21 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862767 9:33447081-33447103 GGTGTGGGAGGCAGGGGAAGTGG No data
1052862747_1052862768 25 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862768 9:33447085-33447107 TGGGAGGCAGGGGAAGTGGCTGG No data
1052862747_1052862766 15 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862766 9:33447075-33447097 TGGAGGGGTGTGGGAGGCAGGGG No data
1052862747_1052862759 -1 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862759 9:33447059-33447081 TGGGATTCTGGGAATCTGGAGGG No data
1052862747_1052862758 -2 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862758 9:33447058-33447080 CTGGGATTCTGGGAATCTGGAGG No data
1052862747_1052862760 0 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862760 9:33447060-33447082 GGGATTCTGGGAATCTGGAGGGG No data
1052862747_1052862761 5 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862761 9:33447065-33447087 TCTGGGAATCTGGAGGGGTGTGG No data
1052862747_1052862764 13 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862764 9:33447073-33447095 TCTGGAGGGGTGTGGGAGGCAGG No data
1052862747_1052862763 9 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862763 9:33447069-33447091 GGAATCTGGAGGGGTGTGGGAGG No data
1052862747_1052862762 6 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862762 9:33447066-33447088 CTGGGAATCTGGAGGGGTGTGGG No data
1052862747_1052862757 -5 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862757 9:33447055-33447077 GGGCTGGGATTCTGGGAATCTGG No data
1052862747_1052862765 14 Left 1052862747 9:33447037-33447059 CCCCTCCCCTACATCTGGGGGCT 0: 1
1: 1
2: 0
3: 25
4: 229
Right 1052862765 9:33447074-33447096 CTGGAGGGGTGTGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052862747 Original CRISPR AGCCCCCAGATGTAGGGGAG GGG (reversed) Intronic
900148542 1:1168485-1168507 AGCCCCACCATGCAGGGGAGCGG + Intergenic
900264997 1:1753013-1753035 CGCACACAGATGGAGGGGAGCGG + Exonic
900314625 1:2050646-2050668 GGCCCCAAGATGGAAGGGAGCGG + Exonic
901045310 1:6392780-6392802 AGCCCCCAGAGGTGGAGGGGAGG - Intronic
901329289 1:8392589-8392611 AGCTCCTAGATGGAGGGGTGGGG - Intronic
901440180 1:9273023-9273045 AGCTCCCAGCAGAAGGGGAGGGG + Intergenic
901660980 1:10797520-10797542 TGCCCCCAGATGGGGGGGAAGGG + Intergenic
901762079 1:11478340-11478362 AGCCCCCAGCTGCAGGGTGGAGG - Intergenic
903373285 1:22850484-22850506 AGCAGCCAGATGTGCGGGAGGGG + Intronic
903625162 1:24725157-24725179 AGCCCCGAGATGGAGGTGGGAGG - Intergenic
904322771 1:29707728-29707750 ATCCCCCAAATGGTGGGGAGGGG - Intergenic
904366093 1:30011801-30011823 AGCCCCCAGATGTGGGGGAGGGG + Intergenic
905247400 1:36624653-36624675 AGCCCCCAGCTGTGAAGGAGGGG - Intergenic
905258093 1:36698362-36698384 AGCCCGCAGAGGTGGGGGTGAGG + Intergenic
906131745 1:43463646-43463668 AGCATGCAGATGTAAGGGAGGGG - Intergenic
906281794 1:44559601-44559623 AGCCCCGGGAGGAAGGGGAGTGG + Intronic
906384227 1:45353540-45353562 CTGCCCCAGATGAAGGGGAGGGG - Intronic
906830672 1:49027953-49027975 TGCCCCCAGTTCTAGGGCAGTGG + Intronic
908764341 1:67540482-67540504 AACTACCAGAAGTAGGGGAGAGG + Intergenic
908821735 1:68093827-68093849 AGTACCCACATGTAGGTGAGGGG + Intergenic
909683619 1:78320814-78320836 AGGCCCCAGAAATAGGAGAGAGG - Intronic
912879813 1:113399374-113399396 AACCCCAAGACGTAAGGGAGGGG + Intronic
915973558 1:160370672-160370694 AGCTCCCAGAGGGAGGGGTGGGG + Exonic
920268987 1:204749061-204749083 AGCACCCAGAGGTGGGGGAAGGG - Intergenic
920307929 1:205030982-205031004 AGACTTCAGATGGAGGGGAGCGG - Intergenic
920531673 1:206706874-206706896 AGCCCCAAGGGGTAGGGAAGGGG - Intronic
920670758 1:208002288-208002310 AGCCAGCAGATGCAGGGGTGTGG - Intergenic
921607952 1:217177319-217177341 TGTCCCCACATGGAGGGGAGAGG - Intergenic
922724777 1:227917753-227917775 AGACCCCACATGCAGGGCAGGGG + Intergenic
923302817 1:232658193-232658215 AGCCCTCAGGTTTAGGGGAAGGG - Intergenic
923525176 1:234767093-234767115 AGCTCCGAGATGGAAGGGAGAGG + Intergenic
1064208481 10:13344983-13345005 AACCCGCAGAGGGAGGGGAGGGG - Exonic
1068183323 10:53551066-53551088 ATCTCCCAGAAGTGGGGGAGGGG - Intergenic
1069737275 10:70665080-70665102 AGCCTCCAGATGTGCGGGAGAGG - Intergenic
1069870291 10:71528830-71528852 AGCCCCCACATGCTGGGGATGGG + Intronic
1070359173 10:75670832-75670854 AGTCCCCTGAGGTAAGGGAGCGG - Intronic
1070964908 10:80524111-80524133 AGCCCCCAGAAGCAGCAGAGTGG + Exonic
1072170949 10:92861244-92861266 TGCCCCCAGATCTAGAGCAGTGG - Intronic
1073770369 10:106728899-106728921 AGGTCTCAGATGTAGAGGAGAGG - Intronic
1074420794 10:113307308-113307330 AGCTGCCAGATGTAGGAGGGTGG - Intergenic
1075037439 10:119080860-119080882 AGGCCCCGGATGTAGGGGGCGGG + Intergenic
1075465017 10:122644729-122644751 AGGCTCCAGATGAATGGGAGGGG - Intergenic
1077040702 11:520720-520742 AGACCCTGGATGGAGGGGAGAGG - Intergenic
1077303749 11:1858729-1858751 GGTCCCTAGATGTTGGGGAGGGG - Intronic
1077507777 11:2940149-2940171 AGCCCCCAGATGACGAGGAAGGG + Intergenic
1078136905 11:8659138-8659160 AGCAACCAGATGAGGGGGAGTGG + Intronic
1079350159 11:19685348-19685370 AGACCCCAGCAGTAGGGGTGGGG + Intronic
1081517981 11:43852161-43852183 AACCCCCAGATCAAGGGGTGGGG - Intronic
1084218567 11:67664608-67664630 TGCCCCCAGGGGTAGGGTAGAGG + Intronic
1084460227 11:69292996-69293018 CTCCCCCAGCTGTAGTGGAGGGG - Intergenic
1084515877 11:69637787-69637809 AGCCCTCGGAGCTAGGGGAGGGG + Intergenic
1084970750 11:72770788-72770810 GGCACCCAGATGAAAGGGAGGGG + Intronic
1090128437 11:124115030-124115052 TTCCCCCTGCTGTAGGGGAGGGG + Intergenic
1091305079 11:134531526-134531548 AGCCCGGGGATGTGGGGGAGAGG - Intergenic
1093212833 12:16328011-16328033 AGAACCCAGATGTAGGGATGGGG + Intergenic
1093536178 12:20226235-20226257 AGACCACAGATGGAGGAGAGAGG + Intergenic
1096182880 12:49560148-49560170 AGGCCCCAGTGGGAGGGGAGGGG + Intronic
1098435984 12:70468512-70468534 AGCCCCTGGAGGTAAGGGAGAGG - Intergenic
1100297337 12:93275179-93275201 AGCCCCCAGAAGCTGGGAAGAGG + Intergenic
1103431856 12:120894594-120894616 AGGCCTCAGATGAAGGGAAGTGG + Intronic
1106024180 13:25941212-25941234 AGGCCCCTGAAGTAGTGGAGGGG - Intronic
1108041113 13:46340003-46340025 AGCCCCCAGAAGCCGGAGAGAGG - Intergenic
1108777369 13:53783417-53783439 TGCTCCCATAGGTAGGGGAGAGG + Intergenic
1109199318 13:59412921-59412943 AAACACCAGATGTAAGGGAGAGG - Intergenic
1113333612 13:109356406-109356428 AGCCCCGAGGTGGAGGGGACAGG + Intergenic
1113348106 13:109500340-109500362 AGCCACCAGGGGCAGGGGAGTGG + Intergenic
1113707365 13:112443527-112443549 AGCCCCCAGAAGTGGCGGAGGGG - Intergenic
1114777262 14:25498150-25498172 AGCTCTCAGATGAAGGGGACTGG - Intergenic
1117051637 14:51866215-51866237 AGCACTCAGAGGTAGAGGAGAGG + Intronic
1119586826 14:75843565-75843587 AGCCACCACATGTAGGGCAATGG + Intronic
1119616877 14:76104666-76104688 TTCCCCCAGGTGGAGGGGAGGGG + Intergenic
1121327410 14:93029289-93029311 AGACCCCAGGTGGAGGTGAGGGG - Intronic
1202832118 14_GL000009v2_random:46427-46449 AGCTCACAGAAGTAGGGGAGAGG - Intergenic
1123491226 15:20784062-20784084 GGCCCACAGCTGTAGGAGAGCGG + Intergenic
1123547728 15:21353153-21353175 GGCCCACAGCTGTAGGAGAGCGG + Intergenic
1125530723 15:40411799-40411821 GGCCCCCAGAGGTGGGGGTGAGG + Intronic
1126101374 15:45120155-45120177 AGCGCCCAGGTGCAGGGGACAGG + Exonic
1127852839 15:62929043-62929065 AGTCCCCACATACAGGGGAGGGG + Intergenic
1127924438 15:63525110-63525132 AGCCCCCAGAAGGAGGAAAGTGG + Intronic
1128092538 15:64928752-64928774 ATCCCCAAGGTGGAGGGGAGAGG + Intronic
1128945801 15:71819807-71819829 AGCCCTTAGAAGTGGGGGAGGGG - Intergenic
1131641422 15:94298366-94298388 AGCCCCCAGATCTACGGGCAAGG + Exonic
1131664625 15:94557094-94557116 AACCCCCAGACTTAGGAGAGAGG + Intergenic
1132196869 15:99920035-99920057 AGCCCCCAGAGCTGGGGGTGGGG - Intergenic
1202956058 15_KI270727v1_random:80383-80405 GGCCCACAGCTGTAGGAGAGCGG + Intergenic
1132641039 16:978715-978737 AGGCCCCAGCTGAAGGGGTGGGG + Intronic
1132643719 16:989381-989403 AGACCCCAGATGAAGGAGATGGG + Intergenic
1133239372 16:4405308-4405330 GGCTTCCAGATGTAGGTGAGCGG + Intronic
1133999083 16:10768692-10768714 AGGCCCCAGAGTTAGGGCAGAGG + Exonic
1136295689 16:29300870-29300892 AGCCCACAGACGTGGGGGTGGGG - Intergenic
1137983838 16:53091418-53091440 ACCTGCCAGATGTAGGGGTGAGG - Intronic
1138549450 16:57739645-57739667 AGCCCACAGAGGGAGGGCAGAGG - Intronic
1139967364 16:70753286-70753308 AGCCCAGAGATGTAGAGGACTGG - Intronic
1141797187 16:86283069-86283091 GGCCACCAGATTCAGGGGAGGGG - Intergenic
1142847235 17:2687861-2687883 AGACCTTAGAGGTAGGGGAGAGG + Intergenic
1144045042 17:11447825-11447847 ATACCCCACATGTATGGGAGGGG + Intronic
1146811922 17:35910641-35910663 AGACTCCAGAGGTAGGGAAGGGG + Intergenic
1147057239 17:37844068-37844090 AGCCCCCAGAGGTTGGGGTGGGG - Intergenic
1147188621 17:38726149-38726171 AGCCCACAGATGTTGGGGGCTGG + Exonic
1148677805 17:49455307-49455329 AGCCCCCATATGGGGGGGAATGG + Intronic
1148699078 17:49577207-49577229 AGGCCCCAGAGGTGGGGTAGAGG - Intronic
1148751200 17:49946885-49946907 AGCCCCCAGTCTGAGGGGAGAGG - Intergenic
1148751224 17:49946969-49946991 AGCCCCCAGTCTGAGGGGAGAGG - Intergenic
1148751250 17:49947053-49947075 AGCCCCCAGTCTGAGGGGAGAGG - Intergenic
1148756118 17:49973818-49973840 AGATCCCAGAGGGAGGGGAGGGG - Exonic
1149023447 17:51996981-51997003 AGCCAACAGATGTAGGCTAGGGG + Intronic
1150601377 17:66653716-66653738 AACCCCCAGATCGAGGAGAGTGG - Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1151551840 17:74826803-74826825 AGGCCCCAGAGGTGGGGTAGTGG + Intronic
1151827257 17:76530282-76530304 AGCCCCCAGATGTGGCGGTTGGG - Intronic
1152003944 17:77665492-77665514 AGCCCCCAGATATAGGGATCTGG + Intergenic
1152291290 17:79441540-79441562 AGCCCCCAGATCTGGGAGAGAGG + Intronic
1152292508 17:79448195-79448217 AGCCCCCAGAAGAGGGGGTGGGG + Intronic
1152637376 17:81435679-81435701 AGGCCCCAGATGGCAGGGAGGGG - Intronic
1158201665 18:54948367-54948389 AACCACCAGAAGCAGGGGAGAGG + Intronic
1158689042 18:59643961-59643983 AGGCTCCAGAGGTGGGGGAGAGG - Intronic
1159624255 18:70673440-70673462 AGGACCCAGATGTAGAGGACAGG + Intergenic
1160266415 18:77343305-77343327 AGCACCCACGTGTTGGGGAGGGG + Intergenic
1160417280 18:78720204-78720226 GGCCACCAGATGCTGGGGAGAGG - Intergenic
1163186131 19:15640890-15640912 ACCTCCCAGAAGAAGGGGAGAGG + Exonic
1163223941 19:15941645-15941667 AGGCCCCACATGCAGGGGTGAGG - Intergenic
1163392419 19:17038645-17038667 AGCCCCCAGGTGAGGGGGACAGG + Intergenic
1163620700 19:18358087-18358109 AGCCACCAGCTGCAGGAGAGAGG - Intronic
1163990847 19:20998072-20998094 AATCCCCACATGTCGGGGAGGGG - Intergenic
1165266959 19:34668426-34668448 AGCCCACAGAGGAGGGGGAGAGG - Intronic
1202640569 1_KI270706v1_random:81344-81366 AGCTCACAGAAGTAGGGGAGGGG + Intergenic
925732294 2:6927993-6928015 GGCCCCCAGATGCAGGCGAGGGG - Intronic
925993100 2:9269521-9269543 AGCCCCCACATGGAGGAGGGTGG + Intronic
926103820 2:10137788-10137810 ACCCCCCTGAAGTAGAGGAGAGG - Intergenic
934496133 2:94801310-94801332 AGCTCACAGAGGTAGGGGAGGGG + Intergenic
934663072 2:96153485-96153507 AGCCCCCAGATCCATGGGGGAGG + Intergenic
935842576 2:107129332-107129354 ACACCCCAGTTGTAGGGGAAGGG + Intergenic
937976894 2:127588047-127588069 AGCCTCCAGAAATAGGAGAGGGG - Intronic
938337304 2:130511339-130511361 AGCCCCCAGCTGTAAGACAGGGG + Intergenic
938352534 2:130609396-130609418 AGCCCCCAGCTGTAAGACAGGGG - Intergenic
940053529 2:149489711-149489733 AGTCCCCAGTTGGAGGAGAGGGG - Intergenic
943214492 2:185013044-185013066 AGCCCCCACACAGAGGGGAGGGG - Intergenic
943569769 2:189559584-189559606 AGACCACAGAAGTAGGGCAGGGG - Intergenic
944433259 2:199659496-199659518 AACCCCCAGAGGGAGGGGAGGGG + Intergenic
944969682 2:204977903-204977925 GGGCTCCAGATGTTGGGGAGAGG + Intronic
946068889 2:217014388-217014410 AATCCCCAGATGTAGGGAGGAGG + Intergenic
947811063 2:233004254-233004276 AGTCCCCAGAAGAAGGGAAGGGG - Intronic
949074088 2:242044279-242044301 AGCCGCCAGAAGTTGGGGAGGGG + Intergenic
1169900743 20:10549519-10549541 AGCTCCCAAATAAAGGGGAGTGG + Intronic
1171354597 20:24534308-24534330 GTGCCCCAGATGGAGGGGAGGGG - Intronic
1172115775 20:32572714-32572736 AGCCCCCAGATCTGGAGGAGAGG - Intronic
1172183975 20:33020110-33020132 AGCCGCCAGCTGTGGGAGAGGGG - Intronic
1173654467 20:44690171-44690193 AGCCCCCACTTGTGGGGGAGGGG + Intergenic
1176447396 21:6831753-6831775 GGCCCACAGCTGTAGGAGAGCGG - Intergenic
1176825564 21:13696779-13696801 GGCCCACAGCTGTAGGAGAGCGG - Intergenic
1179375566 21:40847186-40847208 AGCGGCCAGAGGCAGGGGAGGGG - Intergenic
1179985811 21:44919802-44919824 AGCTCCCAGATCCAGGGGAGGGG + Intronic
1180361373 22:11900538-11900560 AGCTCACAGAAGTAGGGGAGGGG - Intergenic
1180742626 22:18064467-18064489 AGCCCCCACCTGAATGGGAGAGG - Intergenic
1181036404 22:20171777-20171799 AGCCCCCAGGGGCAGGGGATGGG - Intergenic
1181118274 22:20647859-20647881 AGCCAGCTGATGAAGGGGAGAGG - Intergenic
1181169062 22:20998186-20998208 GACCCCCAGATGTAGGTCAGTGG + Exonic
1181527953 22:23500928-23500950 AGCCCCAGGAAGGAGGGGAGGGG - Intergenic
1181571354 22:23769309-23769331 AGCACCCAGAAGTGGGGGTGTGG + Intronic
1182355710 22:29721419-29721441 AGCCCCCATATGGAGTGGAGTGG + Intronic
1184716144 22:46282854-46282876 AGCCCCGAGAGCCAGGGGAGTGG - Intronic
950316122 3:12003870-12003892 AGCCCCCAGAAGAGGGGGAAGGG - Intergenic
950524733 3:13517229-13517251 TGCCCCCAGAGGCAGGGGATGGG + Intergenic
953673670 3:44983298-44983320 TGCCCCCAGAAGCAGGGGAAGGG + Intronic
954134059 3:48573938-48573960 AGCCCCCAGAGGTTGGGAACAGG - Intronic
954839538 3:53498374-53498396 GGCCTCCAGATTTAGGGAAGGGG - Intronic
957952233 3:87141609-87141631 AGCCCCAGCATGGAGGGGAGGGG - Intergenic
958987013 3:100792663-100792685 ATTCTCCAGAGGTAGGGGAGAGG + Intronic
959545431 3:107590763-107590785 AGCTCCAAGATGTAAGAGAGAGG - Intronic
964394169 3:156228230-156228252 AGTCTTCAGATGAAGGGGAGAGG + Intronic
964846606 3:161051159-161051181 AGAGCCCAGATGTATGGGTGTGG - Intronic
1202737986 3_GL000221v1_random:26062-26084 AGCTCACAGAAGTAGTGGAGGGG - Intergenic
968456682 4:704038-704060 AGGCCCCAGATGTGGAGGGGAGG - Intergenic
968521471 4:1036476-1036498 GGCCCTCAGATGTGGCGGAGGGG + Intergenic
968631399 4:1653988-1654010 AGCCCCCAGAGGCAGGGCATGGG + Intronic
969313949 4:6370430-6370452 AACCCCTGGATGTGGGGGAGGGG - Intronic
973384081 4:49491856-49491878 AGCTCACAGAAGTAGGGGAGGGG + Intergenic
975997540 4:80333674-80333696 AACCCCAAGATGTAGGAAAGAGG - Intronic
976289910 4:83406957-83406979 AGCACCCAGATATGGGGTAGGGG + Intergenic
978160309 4:105538930-105538952 AGCCCCCAAATTTATGTGAGGGG - Intergenic
979796951 4:124857875-124857897 AGCCACCAGATGTGGCGGACTGG - Intergenic
980163767 4:129199381-129199403 AGCCCCCAGTTGTAGGGATTTGG - Intergenic
983697885 4:170554731-170554753 AGCACCTAGATGTTGGAGAGGGG - Intergenic
985371346 4:189288808-189288830 AGCCACCAGAAGTTGGGGACAGG - Intergenic
1202767935 4_GL000008v2_random:167183-167205 AGCTCACAGAAGTAGGGGAGGGG + Intergenic
985723527 5:1503171-1503193 AGCCCCCAGAAGCGGGGAAGGGG - Intronic
986258187 5:6119307-6119329 AGCCCCCAGAGGCAGTGAAGAGG + Intergenic
986433582 5:7705593-7705615 AGCCTGCAGATGCAGGGCAGAGG + Intronic
986449629 5:7851233-7851255 AGACCCCAGGTGTAGTCGAGGGG - Exonic
987549579 5:19361203-19361225 AGCCACCAGAAGCTGGGGAGAGG - Intergenic
990655521 5:57950509-57950531 AGCCCACAGATCTCAGGGAGGGG - Intergenic
990977164 5:61570242-61570264 AGCACCCACTTGTAGGGCAGAGG + Intergenic
991723271 5:69514087-69514109 AGCCCCCCAATGTCGAGGAGTGG + Exonic
995809571 5:116089670-116089692 TGCCATCAGAGGTAGGGGAGTGG + Intronic
999235313 5:150087210-150087232 TGACCCCAGATGTAGAGGATGGG - Intronic
1001163479 5:169342169-169342191 AGCCCACAGATGAACAGGAGAGG + Intergenic
1004909534 6:20269812-20269834 AGCCTTCAGAAGAAGGGGAGAGG + Intergenic
1005450032 6:25963360-25963382 AGCTCCCAGGAGTAGGGGTGTGG + Intronic
1006264865 6:32912494-32912516 AGACCACAGGAGTAGGGGAGAGG + Intergenic
1006597201 6:35202147-35202169 AGCCACCTGCTGTATGGGAGAGG + Intergenic
1012929741 6:105304525-105304547 GGCCCCCAGAGGAGGGGGAGGGG - Intronic
1013312426 6:108908330-108908352 AGCCCCCAGCTGGAGGGGCCTGG - Intronic
1016015750 6:139184193-139184215 AGTCCCCAGAAGTAAGTGAGAGG + Intergenic
1016029605 6:139323815-139323837 AGCCATCAGATGTAGGGGAATGG - Intergenic
1017722798 6:157255652-157255674 AGCCCCCAGCTGCAGAGGATGGG - Intergenic
1019125637 6:169838591-169838613 AGCCCCCACATGCAGCTGAGAGG - Intergenic
1019412514 7:912421-912443 AACCCCCACATCTGGGGGAGGGG + Intronic
1019422747 7:958635-958657 CGCCCCGAAATGCAGGGGAGGGG + Intronic
1019625659 7:2014494-2014516 AGCGCCGAGATGGAGGTGAGGGG - Exonic
1022339567 7:29455673-29455695 AGGCACCAGAGGTTGGGGAGGGG + Intronic
1022621239 7:31986688-31986710 AGCCACCAGATGCTGGGAAGAGG + Intronic
1024021246 7:45372973-45372995 AGCTCCCAGTTGTAGGTGTGTGG + Intergenic
1027046277 7:74993401-74993423 ACCACCCAGATGTAGAGGTGGGG - Intronic
1028972710 7:96876231-96876253 AGCTCCTAGAACTAGGGGAGTGG - Intergenic
1029751512 7:102545153-102545175 AGCACCCCGATCCAGGGGAGAGG - Intronic
1029769464 7:102644244-102644266 AGCACCCCGATCCAGGGGAGAGG - Intronic
1032460010 7:132103316-132103338 TGCCCCCAGCTGTTGGCGAGTGG + Intergenic
1034223663 7:149465167-149465189 AGCACACAGATGAACGGGAGGGG + Intergenic
1035125708 7:156607039-156607061 AGTGCCCAGATGAAGGGGGGTGG - Intergenic
1036633193 8:10529759-10529781 AGCCACCAGGTGTGGGTGAGGGG - Intronic
1042316971 8:67435408-67435430 AGCCCACAGATGTTGGGGGCTGG + Intronic
1042501537 8:69514592-69514614 AGCCCCCTAAAGTGGGGGAGTGG + Intronic
1042730384 8:71927103-71927125 AGGAAGCAGATGTAGGGGAGAGG - Intronic
1044532585 8:93324625-93324647 AGAGACCAGATGTAGGGGAAAGG - Intergenic
1046487749 8:114909172-114909194 AGCTCCCAGAGGTAGGAGGGAGG + Intergenic
1047102119 8:121688646-121688668 AGCCACCAGATGCTGGGAAGTGG + Intergenic
1047762669 8:127965731-127965753 AGTTCCTAGATGTAGGGCAGAGG - Intergenic
1049328560 8:142037786-142037808 AGCCCCCAGGTCTTGGGAAGGGG - Intergenic
1049513860 8:143043410-143043432 AGCCAGCAGATGTTGGGGTGCGG - Intronic
1052862747 9:33447037-33447059 AGCCCCCAGATGTAGGGGAGGGG - Intronic
1053398977 9:37800970-37800992 AGCCCCGGGATGTAGTGGCGAGG - Exonic
1053661006 9:40279071-40279093 AGCTCACAGAGGTAGGGGAGGGG - Intronic
1053911383 9:42908408-42908430 AGCTCACAGAGGTAGGGGAGGGG - Intergenic
1054361999 9:64131963-64131985 AGCTCATAGAAGTAGGGGAGGGG - Intergenic
1054373126 9:64425286-64425308 AGCTCACAGAGGTAGGGGAGGGG - Intergenic
1054523604 9:66097213-66097235 AGCTCACAGAGGTAGGGGAGGGG + Intergenic
1054680758 9:67915064-67915086 AGCTCACAGAGGTAGGGGAGGGG - Intergenic
1057266330 9:93620283-93620305 AGGACCCAGATGTGGGGAAGTGG - Intronic
1059535979 9:115081214-115081236 AGCACCCAGTTGTAGGACAGAGG - Intronic
1060477358 9:123996696-123996718 GATCCCCAGATGTAGGGGTGTGG - Intergenic
1060479784 9:124011469-124011491 AGACCCAAGAGGGAGGGGAGAGG - Intronic
1061196318 9:129109033-129109055 AGCTCCCAGAAGTAGAGGAATGG + Intronic
1061256295 9:129455562-129455584 AGCCCCAAGGAGGAGGGGAGAGG + Intergenic
1061792821 9:133067347-133067369 AGGCCCCAGCTGTAAGGGAGAGG + Intronic
1203706714 Un_KI270742v1:56506-56528 AGCTCACAGAAGTAGGGGAGGGG - Intergenic
1185613100 X:1403620-1403642 GGCCCACACAGGTAGGGGAGGGG + Intronic
1187390869 X:18886004-18886026 AGCCCCAATATGAAGGGCAGTGG + Intergenic
1189242678 X:39537637-39537659 AGCCCCCTGATGTTGGGAATGGG + Intergenic
1191055171 X:56233156-56233178 AGCCCGGAGAAATAGGGGAGTGG + Exonic
1192237592 X:69305908-69305930 AGCCCGGAGAGGGAGGGGAGGGG + Intergenic
1192312572 X:70028834-70028856 AGCCCCAAGATACAGGGCAGGGG - Intronic
1192369752 X:70503638-70503660 AGCTACCAGCTGTTGGGGAGGGG - Exonic
1192727673 X:73769193-73769215 AACCCACAGAGGGAGGGGAGGGG + Intergenic
1195312225 X:103642947-103642969 AGCTACCTGAGGTAGGGGAGGGG - Intergenic
1198307778 X:135399952-135399974 AAGCCTTAGATGTAGGGGAGGGG - Intergenic
1200127094 X:153820786-153820808 AGCCGCCAGATGCAGGGCTGGGG - Intronic