ID: 1052871783

View in Genome Browser
Species Human (GRCh38)
Location 9:33514623-33514645
Sequence CCAGCAACAAGGGAAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052871783_1052871793 16 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG No data
1052871783_1052871791 4 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871791 9:33514650-33514672 ACAGGTGCAGGGTGATGCTCAGG No data
1052871783_1052871789 -8 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871789 9:33514638-33514660 GTTGCTGGGACAACAGGTGCAGG No data
1052871783_1052871795 30 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871795 9:33514676-33514698 GCCAGTGGGTGAGTGCGTGGAGG No data
1052871783_1052871794 27 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871794 9:33514673-33514695 ACAGCCAGTGGGTGAGTGCGTGG No data
1052871783_1052871792 15 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871792 9:33514661-33514683 GTGATGCTCAGGACAGCCAGTGG No data
1052871783_1052871790 -7 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871790 9:33514639-33514661 TTGCTGGGACAACAGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052871783 Original CRISPR CCAGCAACAAGGGAAAAATA AGG (reversed) Intergenic