ID: 1052871788

View in Genome Browser
Species Human (GRCh38)
Location 9:33514634-33514656
Sequence CACCTGTTGTCCCAGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052871788_1052871798 23 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871798 9:33514680-33514702 GTGGGTGAGTGCGTGGAGGGAGG No data
1052871788_1052871792 4 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871792 9:33514661-33514683 GTGATGCTCAGGACAGCCAGTGG No data
1052871788_1052871794 16 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871794 9:33514673-33514695 ACAGCCAGTGGGTGAGTGCGTGG No data
1052871788_1052871793 5 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG No data
1052871788_1052871791 -7 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871791 9:33514650-33514672 ACAGGTGCAGGGTGATGCTCAGG No data
1052871788_1052871795 19 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871795 9:33514676-33514698 GCCAGTGGGTGAGTGCGTGGAGG No data
1052871788_1052871797 20 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871797 9:33514677-33514699 CCAGTGGGTGAGTGCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052871788 Original CRISPR CACCTGTTGTCCCAGCAACA AGG (reversed) Intergenic