ID: 1052871793

View in Genome Browser
Species Human (GRCh38)
Location 9:33514662-33514684
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052871787_1052871793 6 Left 1052871787 9:33514633-33514655 CCCTTGTTGCTGGGACAACAGGT No data
Right 1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG No data
1052871783_1052871793 16 Left 1052871783 9:33514623-33514645 CCTTATTTTTCCCTTGTTGCTGG No data
Right 1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG No data
1052871788_1052871793 5 Left 1052871788 9:33514634-33514656 CCTTGTTGCTGGGACAACAGGTG No data
Right 1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052871793 Original CRISPR TGATGCTCAGGACAGCCAGT GGG Intergenic