ID: 1052881305

View in Genome Browser
Species Human (GRCh38)
Location 9:33602387-33602409
Sequence AGGGAGTCCCATTTCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052881300_1052881305 19 Left 1052881300 9:33602345-33602367 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1052881305 9:33602387-33602409 AGGGAGTCCCATTTCAGGTGTGG No data
1052881299_1052881305 28 Left 1052881299 9:33602336-33602358 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1052881305 9:33602387-33602409 AGGGAGTCCCATTTCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052881305 Original CRISPR AGGGAGTCCCATTTCAGGTG TGG Intergenic
No off target data available for this crispr