ID: 1052886053

View in Genome Browser
Species Human (GRCh38)
Location 9:33649151-33649173
Sequence CTGTGTGGCCTTTTGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052886050_1052886053 -10 Left 1052886050 9:33649138-33649160 CCCTGCTCCTCTTCTGTGTGGCC No data
Right 1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG No data
1052886044_1052886053 17 Left 1052886044 9:33649111-33649133 CCATCATTCCTCTTCATGCCATG No data
Right 1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG No data
1052886046_1052886053 9 Left 1052886046 9:33649119-33649141 CCTCTTCATGCCATGGCCTCCCT No data
Right 1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG No data
1052886047_1052886053 -1 Left 1052886047 9:33649129-33649151 CCATGGCCTCCCTGCTCCTCTTC No data
Right 1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG No data
1052886048_1052886053 -7 Left 1052886048 9:33649135-33649157 CCTCCCTGCTCCTCTTCTGTGTG No data
Right 1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG No data
1052886043_1052886053 20 Left 1052886043 9:33649108-33649130 CCTCCATCATTCCTCTTCATGCC No data
Right 1052886053 9:33649151-33649173 CTGTGTGGCCTTTTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052886053 Original CRISPR CTGTGTGGCCTTTTGTCTCC TGG Intergenic
No off target data available for this crispr