ID: 1052886368

View in Genome Browser
Species Human (GRCh38)
Location 9:33652043-33652065
Sequence CTCACTAGACAGGGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052886368_1052886374 -8 Left 1052886368 9:33652043-33652065 CCCTCCTTCCCCTGTCTAGTGAG No data
Right 1052886374 9:33652058-33652080 CTAGTGAGCCCCAGTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052886368 Original CRISPR CTCACTAGACAGGGGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr