ID: 1052887084

View in Genome Browser
Species Human (GRCh38)
Location 9:33660159-33660181
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052887084_1052887091 9 Left 1052887084 9:33660159-33660181 CCTACTTCCATGTGGTCCCAGAG No data
Right 1052887091 9:33660191-33660213 AGGAGATGTTTATCACTATTTGG No data
1052887084_1052887092 10 Left 1052887084 9:33660159-33660181 CCTACTTCCATGTGGTCCCAGAG No data
Right 1052887092 9:33660192-33660214 GGAGATGTTTATCACTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052887084 Original CRISPR CTCTGGGACCACATGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr