ID: 1052891262

View in Genome Browser
Species Human (GRCh38)
Location 9:33702339-33702361
Sequence CCGTCTAGGAAGGAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052891248_1052891262 21 Left 1052891248 9:33702295-33702317 CCAGGAGAGCCCTGGATGTAATG No data
Right 1052891262 9:33702339-33702361 CCGTCTAGGAAGGAGATGGATGG No data
1052891253_1052891262 11 Left 1052891253 9:33702305-33702327 CCTGGATGTAATGGAAAGTGGGG No data
Right 1052891262 9:33702339-33702361 CCGTCTAGGAAGGAGATGGATGG No data
1052891251_1052891262 12 Left 1052891251 9:33702304-33702326 CCCTGGATGTAATGGAAAGTGGG No data
Right 1052891262 9:33702339-33702361 CCGTCTAGGAAGGAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052891262 Original CRISPR CCGTCTAGGAAGGAGATGGA TGG Intergenic
No off target data available for this crispr