ID: 1052891573

View in Genome Browser
Species Human (GRCh38)
Location 9:33705060-33705082
Sequence CTGGCTTAGGACGCTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052891571_1052891573 -8 Left 1052891571 9:33705045-33705067 CCTTATGATAGAACACTGGCTTA No data
Right 1052891573 9:33705060-33705082 CTGGCTTAGGACGCTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052891573 Original CRISPR CTGGCTTAGGACGCTTTTCA AGG Intergenic
No off target data available for this crispr