ID: 1052894514

View in Genome Browser
Species Human (GRCh38)
Location 9:33734803-33734825
Sequence TAGCCCTCCCCAATGACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052894514_1052894520 4 Left 1052894514 9:33734803-33734825 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1052894520 9:33734830-33734852 AGGCACTGGGAAAAGGCCACAGG 0: 18
1: 36
2: 74
3: 96
4: 446
1052894514_1052894516 -10 Left 1052894514 9:33734803-33734825 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1052894516 9:33734816-33734838 GGGAGGGCTACCAGAGGCACTGG No data
1052894514_1052894521 5 Left 1052894514 9:33734803-33734825 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1052894521 9:33734831-33734853 GGCACTGGGAAAAGGCCACAGGG 0: 15
1: 36
2: 82
3: 99
4: 435
1052894514_1052894518 -3 Left 1052894514 9:33734803-33734825 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1052894518 9:33734823-33734845 CTACCAGAGGCACTGGGAAAAGG No data
1052894514_1052894522 11 Left 1052894514 9:33734803-33734825 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1052894522 9:33734837-33734859 GGGAAAAGGCCACAGGGAGAAGG 0: 25
1: 85
2: 115
3: 318
4: 928
1052894514_1052894517 -9 Left 1052894514 9:33734803-33734825 CCAGGGGTCATTGGGGAGGGCTA No data
Right 1052894517 9:33734817-33734839 GGAGGGCTACCAGAGGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052894514 Original CRISPR TAGCCCTCCCCAATGACCCC TGG (reversed) Intergenic
No off target data available for this crispr