ID: 1052895472

View in Genome Browser
Species Human (GRCh38)
Location 9:33743610-33743632
Sequence GACAATTCTTGGTCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052895472_1052895475 4 Left 1052895472 9:33743610-33743632 CCAGTAGCAGACCAAGAATTGTC No data
Right 1052895475 9:33743637-33743659 AAAAGACACTCCTGCAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052895472 Original CRISPR GACAATTCTTGGTCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr