ID: 1052904032

View in Genome Browser
Species Human (GRCh38)
Location 9:33817910-33817932
Sequence TGAAGTAGCCGCCTTCGTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052904032_1052904046 28 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904032_1052904034 0 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904032_1052904040 15 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904032_1052904043 21 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052904032 Original CRISPR TGAAGTAGCCGCCTTCGTAG AGG (reversed) Exonic
902154143 1:14470263-14470285 TGAAGCAGCCTCCTTAGAAGAGG + Intergenic
907268957 1:53279376-53279398 TGCAGTAGCGGCCTTCATATTGG + Intronic
915522781 1:156457518-156457540 TGCGGTCCCCGCCTTCGTAGGGG - Intergenic
1069080518 10:64083651-64083673 TGAAGTAGCTGCATTTGTAGGGG - Intergenic
1099014913 12:77332813-77332835 TGAAGGAGCCACCTTGGTAGAGG + Intergenic
1113425190 13:110201640-110201662 TGAAGTAGCAGCAATGGTAGCGG + Intronic
1124441438 15:29688921-29688943 TGAAGTAGACGCCATCATCGTGG + Intergenic
1134684973 16:16152250-16152272 TGGAGTAGCACCCTTCGTGGAGG + Intronic
934942895 2:98515274-98515296 TAAAGTAGCCTCTTTCTTAGAGG + Intronic
1172138992 20:32708521-32708543 GGAAGTAGCCACCTTCTCAGAGG - Intronic
1184078168 22:42197235-42197257 TCAAGTAGCCTCCTTGGTGGAGG - Intronic
958593365 3:96189670-96189692 TGAAGTAGCTGCCTTGCAAGTGG + Intergenic
980058531 4:128103436-128103458 TGAATTACCTGCCTTGGTAGTGG + Intronic
1010812395 6:80315126-80315148 AGATTTAGCCGCCTTCCTAGGGG + Intronic
1011748889 6:90435319-90435341 TGAAGTAGCCCCCATGATAGGGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1024262828 7:47584419-47584441 TGAAGTTGCAGCCTGCGAAGTGG - Intergenic
1049710026 8:144059283-144059305 GGAAGAAGCTGCCTTCGTGGGGG - Intronic
1052828669 9:33197040-33197062 TGGAGAAGCTGCCTTCATAGAGG - Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1053800896 9:41764074-41764096 TCAAGTGGCCGCCTTCACAGAGG + Intergenic
1054144299 9:61550765-61550787 TCAAGTGGCCGCCTTCACAGAGG - Intergenic
1054189327 9:61976224-61976246 TCAAGTGGCCGCCTTCACAGAGG + Intergenic
1054463986 9:65481724-65481746 TCAAGTGGCCGCCTTCACAGAGG - Intergenic
1054649188 9:67612387-67612409 TCAAGTGGCCGCCTTCACAGAGG - Intergenic
1059890841 9:118801816-118801838 TTATGTAGCAGCCTTCGTATAGG - Intergenic
1061455909 9:130697591-130697613 TGAAGTAGGAGACATCGTAGTGG + Exonic