ID: 1052904034

View in Genome Browser
Species Human (GRCh38)
Location 9:33817933-33817955
Sequence AGGTACCCTCACCCTCCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052904031_1052904034 1 Left 1052904031 9:33817909-33817931 CCCTCTACGAAGGCGGCTACTTC 0: 1
1: 0
2: 1
3: 4
4: 30
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904026_1052904034 10 Left 1052904026 9:33817900-33817922 CCCCCAACACCCTCTACGAAGGC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904028_1052904034 8 Left 1052904028 9:33817902-33817924 CCCAACACCCTCTACGAAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 30
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904032_1052904034 0 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904030_1052904034 7 Left 1052904030 9:33817903-33817925 CCAACACCCTCTACGAAGGCGGC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904023_1052904034 22 Left 1052904023 9:33817888-33817910 CCATCTTCGGACCCCCCAACACC 0: 1
1: 1
2: 0
3: 12
4: 174
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904024_1052904034 11 Left 1052904024 9:33817899-33817921 CCCCCCAACACCCTCTACGAAGG 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200
1052904027_1052904034 9 Left 1052904027 9:33817901-33817923 CCCCAACACCCTCTACGAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG 0: 1
1: 0
2: 3
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052904034 Original CRISPR AGGTACCCTCACCCTCCTCC CGG Exonic
900473749 1:2866751-2866773 AGGTTCCCTCACGCTCGGCCCGG + Intergenic
901053383 1:6437175-6437197 TGGTACCCACAGCCTCCTGCAGG - Intronic
901239238 1:7683453-7683475 ACCTACCCTCTCCCACCTCCGGG + Intronic
901693813 1:10991629-10991651 GGGTCTCCTCGCCCTCCTCCAGG + Intergenic
901887185 1:12230878-12230900 CGGAACCCTCAGCCCCCTCCAGG - Intronic
902629623 1:17696942-17696964 GGGGCCCCTCAGCCTCCTCCTGG - Exonic
902843071 1:19087738-19087760 AGGTAGCATCCCCCTCCTCCAGG - Intronic
906239059 1:44230305-44230327 AGGAAGCCTCACCTTTCTCCTGG + Intronic
906669709 1:47645542-47645564 AGGTACCCTAGTCCTCCTCCAGG - Intergenic
909491541 1:76232373-76232395 AGGTCCACTCACCCCACTCCAGG + Intronic
913221933 1:116667232-116667254 AGGTAGCCCCACCCTCCGCCAGG + Intronic
914853225 1:151330545-151330567 AGGGACCCTCCTCCACCTCCTGG + Intergenic
915304572 1:154970199-154970221 AGGCCCCCTACCCCTCCTCCAGG - Exonic
915316987 1:155034283-155034305 AGGCTCCCTCATCCTCCTCCAGG + Intronic
915484086 1:156208025-156208047 CACTTCCCTCACCCTCCTCCTGG + Intronic
916723615 1:167503789-167503811 CGGTAGCCTACCCCTCCTCCAGG - Intronic
917329749 1:173868668-173868690 AGATACGCACACCCACCTCCTGG + Intronic
917456785 1:175192716-175192738 AGGAACCCACACCTCCCTCCAGG - Exonic
917891304 1:179441027-179441049 TGATTCCCTCACCCTACTCCAGG - Intronic
918103333 1:181395629-181395651 AGGTACCAAGAACCTCCTCCTGG + Intergenic
920964658 1:210691895-210691917 TGGTAACCTCAGCATCCTCCAGG - Intronic
921259092 1:213369744-213369766 AGGTTCCCTCCCCATCCTGCTGG - Intergenic
922464894 1:225839877-225839899 CTCTACCCTGACCCTCCTCCTGG + Exonic
923612026 1:235504288-235504310 AGGTCCCCTCCCTCTCCGCCGGG - Exonic
1062938979 10:1407738-1407760 TGGTGCCCTCCCCCACCTCCAGG + Intronic
1063522257 10:6751594-6751616 AGGCACCCTCAGCCACCGCCAGG - Intergenic
1065673320 10:28146078-28146100 AGCTAACCTCACCCTCCCCTGGG + Intronic
1066565493 10:36717605-36717627 ACTTAACCTGACCCTCCTCCAGG - Intergenic
1069157825 10:65052330-65052352 AGGTGCCCCCACCTCCCTCCCGG - Intergenic
1070720968 10:78756869-78756891 GGGGAGCCTCAGCCTCCTCCAGG + Intergenic
1070720978 10:78756947-78756969 AGCTTCCCCCATCCTCCTCCTGG + Intergenic
1073114126 10:101081406-101081428 AGGTACCTGCACCCTTCCCCAGG - Intergenic
1074523820 10:114247838-114247860 AGGGGCCCTCATCCTCATCCTGG - Intronic
1075716261 10:124557617-124557639 CTGCACCCTCACCCTCCTCTAGG - Intronic
1077365616 11:2160356-2160378 AGGCAGCCACGCCCTCCTCCGGG + Intronic
1077434986 11:2534614-2534636 GGGTACCCACTCCCTCCTCAGGG + Intronic
1078633970 11:13031589-13031611 TGTTTCCCTCACCCTCCTCTTGG + Intergenic
1079241393 11:18724544-18724566 AGGTATCCTCAACTCCCTCCAGG - Intronic
1080742498 11:35079404-35079426 AGGTGCTTTCAGCCTCCTCCAGG - Intergenic
1083163849 11:60871667-60871689 CCGTAGCCTCAGCCTCCTCCTGG - Intronic
1083785855 11:64946508-64946530 AAGTACCCTCACATTCCACCTGG + Intronic
1083799391 11:65037812-65037834 AGGTGCCTTCTCCCTCCTGCAGG + Intronic
1083820948 11:65171114-65171136 TGGCACCCTCACCCTCCTCCTGG - Intronic
1085456736 11:76669928-76669950 AGGTCCTCTCTCCCTCCTCTCGG + Exonic
1086452582 11:86931886-86931908 GGCTACCGTCACCCTTCTCCTGG - Intronic
1087077642 11:94140236-94140258 AGGTCCCCTCACCTTACTGCTGG + Intronic
1088222218 11:107581215-107581237 CAATACCCTCACCCTCCTCTGGG + Intergenic
1089620021 11:119716770-119716792 GGGGGCCCTCACCCCCCTCCTGG - Intronic
1090169135 11:124582811-124582833 ATCAACCCCCACCCTCCTCCTGG + Intergenic
1090974740 11:131671515-131671537 GGCTGCCCTCACCCTCCTCTGGG + Intronic
1091319562 11:134640077-134640099 AGGGAGCCGCACCCTTCTCCAGG - Intergenic
1091445043 12:540170-540192 AGGCACCGTCAGCCTCCTCCAGG - Intronic
1093955699 12:25215958-25215980 CGATTCCCACACCCTCCTCCAGG + Intronic
1097360846 12:58656423-58656445 AGCTGCCCTCACCCCCCACCTGG + Intronic
1101397210 12:104358878-104358900 AGAAACCCTCACCCACCTCTAGG - Intergenic
1102505443 12:113381595-113381617 GGGTTCCCTCACCCACCGCCTGG - Intronic
1104526857 12:129532227-129532249 AGGTACCATCAGCGTGCTCCAGG - Intronic
1104715435 12:131013111-131013133 GGCTTCCCTCACCCTCCTCCTGG + Intronic
1112504524 13:99968303-99968325 AGGGACCCCCACGCTCCACCGGG + Intronic
1113426283 13:110211091-110211113 AGGGACTCTCACCTTCATCCAGG + Intronic
1114455038 14:22848696-22848718 AGGAACCCTGACCCTACGCCTGG + Intronic
1116372464 14:44153662-44153684 AGTTTTCCTCACCCTCATCCTGG + Intergenic
1117392248 14:55272588-55272610 AGATCCACTCTCCCTCCTCCTGG - Intronic
1117504841 14:56391685-56391707 ATGTACCCCCACCCTACTCCAGG - Intergenic
1118014330 14:61643083-61643105 AGGTATCATCACACTCCTCCTGG + Intronic
1119174837 14:72561534-72561556 CGTGCCCCTCACCCTCCTCCTGG + Intronic
1119329380 14:73782860-73782882 AGCTGCCCTCAGGCTCCTCCTGG - Intronic
1119647310 14:76357015-76357037 AGGAGCCCACACCCTCCCCCAGG - Intronic
1121617307 14:95321169-95321191 GGGTAGACTCACCCTCCTTCAGG - Intergenic
1121781693 14:96626139-96626161 AGGGACCAGCACCCTCATCCTGG + Intergenic
1123755627 15:23395613-23395635 AAGCACCCACAGCCTCCTCCTGG + Intergenic
1124433085 15:29623808-29623830 ACTCACCCTCTCCCTCCTCCTGG + Intergenic
1129468672 15:75738396-75738418 AGGTGCCCTCGCGCCCCTCCCGG - Intergenic
1131365002 15:91831441-91831463 GGGTTCCCACACCCCCCTCCTGG - Intergenic
1132761628 16:1511236-1511258 AGGCACCCCCACCCGCCTCCAGG - Intronic
1133278494 16:4652050-4652072 AGGTAACTTCACCCTGCCCCTGG + Exonic
1133771238 16:8868395-8868417 AGGCACCCCCACCCCCATCCGGG + Exonic
1134460749 16:14427412-14427434 AAGCACCCACAGCCTCCTCCTGG - Intergenic
1134673496 16:16073180-16073202 GGTTTCCATCACCCTCCTCCAGG - Intronic
1137399011 16:48138117-48138139 GGGTCCCCTCAGCCTCCTTCTGG + Intronic
1138414303 16:56862579-56862601 CCCTACCCTGACCCTCCTCCAGG + Intergenic
1140701922 16:77588911-77588933 AGGTACTCTAACCCTTGTCCAGG + Intergenic
1141586566 16:85037829-85037851 ACGTCCTCTCTCCCTCCTCCAGG + Intronic
1141634759 16:85308312-85308334 AGGTTCCCTCAGCGTCCTCCCGG - Intergenic
1141669130 16:85482326-85482348 AAGCACCCACGCCCTCCTCCAGG - Intergenic
1143490636 17:7283544-7283566 AGGCACCCTCACCACCCTCTGGG + Exonic
1147335709 17:39725879-39725901 AGGACCTCCCACCCTCCTCCAGG - Intronic
1149547369 17:57513686-57513708 AGGGAGCCTCACCCCCCTCCCGG + Intronic
1150812596 17:68368464-68368486 AGGGATCCTCCCTCTCCTCCAGG - Intronic
1150815844 17:68391236-68391258 AGGGACCGTCTCCCTCTTCCAGG + Intronic
1151464825 17:74277678-74277700 ACCTACCCTCTCCCGCCTCCAGG - Intronic
1152162822 17:78679700-78679722 AGGAAGCTTCTCCCTCCTCCCGG + Intronic
1154411034 18:14142486-14142508 GGGCACCCTCACCCCACTCCAGG + Intergenic
1156257512 18:35411632-35411654 AGTAATCCTCACCCTCCTGCAGG + Intergenic
1156308026 18:35897218-35897240 AGGGACCCTCACACTGGTCCAGG - Intergenic
1156360627 18:36381511-36381533 TGGCACCCTCATCCTCCTCTCGG - Intronic
1160318372 18:77868470-77868492 AGATGCCCTCACCCTAATCCTGG + Intergenic
1160618362 18:80151099-80151121 AGGTGCCCTCCCCCATCTCCAGG - Intronic
1161566471 19:5005543-5005565 TGGGGGCCTCACCCTCCTCCGGG + Intronic
1163330966 19:16637427-16637449 ATGTAGCCTCAACCTCCCCCAGG - Intronic
1164151686 19:22559063-22559085 AGGTACCATTAACCTCCTCTTGG - Intergenic
1164598113 19:29543518-29543540 AGGGACCTACAGCCTCCTCCCGG + Intronic
1165745640 19:38228539-38228561 CGCTCCCCTCCCCCTCCTCCCGG - Intronic
1166230427 19:41423159-41423181 GGGCACCCTCACCTTCCTGCGGG - Exonic
1166294221 19:41881115-41881137 GGGTAACCTCACTCTTCTCCAGG + Exonic
1167253447 19:48413964-48413986 ATGTCCCCTTTCCCTCCTCCTGG + Intronic
1167744471 19:51342444-51342466 AGGTCACCTCACCCTCCTCCAGG - Intergenic
1168254367 19:55157685-55157707 AGGGACCGTCAGTCTCCTCCGGG + Exonic
925589214 2:5493439-5493461 AGGGACCCTCCACCTCCACCCGG - Intergenic
926275645 2:11401221-11401243 AGGGAGCTTCACCCTCTTCCAGG - Intergenic
927511895 2:23649241-23649263 TGATACACACACCCTCCTCCAGG + Intronic
930747911 2:54903827-54903849 GGGTCCCCTCATCCTCCTCCTGG + Intronic
930927719 2:56839791-56839813 AGTTACCCTAACCCTCCTCATGG + Intergenic
932674045 2:73762806-73762828 AGACACCATCTCCCTCCTCCTGG - Exonic
934858059 2:97741300-97741322 AAGCCCCTTCACCCTCCTCCAGG + Intergenic
936433984 2:112487305-112487327 AGGAAGCCTCACTCTCCTTCAGG - Intronic
936452015 2:112640931-112640953 TGTTACCCTCCACCTCCTCCTGG + Intergenic
941711313 2:168716711-168716733 AGGTACCTTCTACCTTCTCCTGG - Intronic
943496762 2:188630094-188630116 AGGTCCCCTGCCCTTCCTCCAGG - Intergenic
948873947 2:240817739-240817761 AGATGCCCTCAGTCTCCTCCAGG + Intronic
1168815914 20:736941-736963 TGGTCCCCACAGCCTCCTCCTGG - Intergenic
1168849790 20:968713-968735 TGAGACCCTCACCCTCCTGCTGG + Intronic
1169030536 20:2403484-2403506 GCGTACCTTCACTCTCCTCCTGG - Exonic
1169141560 20:3229865-3229887 GGGTCCCCTCACCTTCCCCCTGG - Intronic
1170305095 20:14929626-14929648 AGCTCCACTCTCCCTCCTCCAGG - Intronic
1172484888 20:35292127-35292149 AGGCAGCCTCACCCCGCTCCAGG + Exonic
1172837937 20:37884973-37884995 AGGTGCCCATTCCCTCCTCCTGG + Intergenic
1172885523 20:38228299-38228321 AGGTTCCCTCACCTTCCACTAGG - Intronic
1174487578 20:50870985-50871007 AGCTCCCCACCCCCTCCTCCCGG - Intronic
1176186739 20:63784293-63784315 TGGGACCCTCACTCCCCTCCCGG + Intronic
1176862021 21:14015929-14015951 GGGCACCCTCACCCCACTCCAGG - Intergenic
1179275214 21:39885694-39885716 AGGCACCCTCTCCCTCCCCTGGG + Intronic
1180001452 21:44997211-44997233 CGGGGCACTCACCCTCCTCCTGG - Intergenic
1181695829 22:24592423-24592445 GGGTAACTTCCCCCTCCTCCAGG - Intronic
1181760442 22:25054742-25054764 AGACACCCCCTCCCTCCTCCAGG - Intronic
1181810410 22:25400629-25400651 AAATACCTTCACCCACCTCCTGG + Intronic
1182287866 22:29258854-29258876 AGGCACCCCCAGCCTCCTTCGGG + Exonic
1183365960 22:37406937-37406959 AGGTTCCCGCCCCATCCTCCAGG + Intronic
1184273114 22:43395953-43395975 AGGCACCCTCACCCTCCTCTGGG + Intergenic
1184771446 22:46599019-46599041 TGGGACCCCCATCCTCCTCCGGG - Intronic
1185032224 22:48450183-48450205 AGGTACCCTCACTCTCCCAGTGG + Intergenic
1185198829 22:49490029-49490051 GGGTATCCTCAGCCTCATCCAGG + Intronic
949355417 3:3175701-3175723 AGGTCCCCCTACCCTCCTCTGGG + Intronic
949585287 3:5431200-5431222 AGGCTCCTTCATCCTCCTCCTGG - Intergenic
953570901 3:44070848-44070870 AGTTACCCTCATTCTACTCCTGG + Intergenic
963776369 3:149444996-149445018 AGGTGCCCCCACCTCCCTCCCGG + Intergenic
967134540 3:186502334-186502356 AGGTACAGACACCCTCCCCCAGG - Intergenic
968539465 4:1156437-1156459 AGGTTCCCTCAGCCTCTGCCTGG + Intergenic
968618980 4:1595196-1595218 AGGGACCCCCGCCCACCTCCAGG + Intergenic
968978905 4:3836294-3836316 AGGGCCACTCACCCTCGTCCAGG + Intergenic
969320298 4:6408411-6408433 AGGTAGCCACACCCTCCTAGAGG + Intronic
970253414 4:14141321-14141343 AGGTAGCCACAGGCTCCTCCTGG + Intergenic
970940113 4:21621955-21621977 AGGGATCCTCACCCTACTTCAGG + Intronic
971484879 4:27148837-27148859 AAGTACACTCACCCATCTCCAGG - Intergenic
972168337 4:36314231-36314253 AGATACCATGACCCTTCTCCCGG - Intronic
972566813 4:40276841-40276863 AAGGACCATCTCCCTCCTCCTGG - Intergenic
972739106 4:41873988-41874010 ATTTACCCTCATCCTCCTCCAGG + Intergenic
979142021 4:117188453-117188475 CGGTACCCTCATCCTATTCCCGG - Intergenic
981237225 4:142433438-142433460 TGGTTCTCTCACCCTCCCCCAGG + Intronic
982688886 4:158526317-158526339 AGTTTACCTCTCCCTCCTCCTGG + Intronic
983826161 4:172263844-172263866 AGGTACCCTGACTCTTCTCATGG + Intronic
985765726 5:1778476-1778498 AGCTCCCCTCACCCCCCTCGGGG + Intergenic
985893879 5:2737985-2738007 AGGTCTCCTCCCACTCCTCCCGG + Intergenic
991504127 5:67306432-67306454 TGGTACTCTCTCACTCCTCCAGG - Intergenic
997433186 5:133855522-133855544 AATTAACCTCTCCCTCCTCCTGG - Intergenic
997660538 5:135586200-135586222 GCGTCCCCCCACCCTCCTCCTGG - Intergenic
997890707 5:137673764-137673786 AGGTACCCTCACAGCCCTCAAGG + Intronic
998682107 5:144479872-144479894 GATTACCCCCACCCTCCTCCAGG - Exonic
999096622 5:148983919-148983941 AGGTACTATCAACCTGCTCCTGG + Intronic
1000040415 5:157480829-157480851 AGCTCCTCCCACCCTCCTCCAGG - Exonic
1001353400 5:170996200-170996222 AGGGACCCTCTCCTTCCTCACGG + Intronic
1003062800 6:2875981-2876003 AGCTACCCGCTCCCTCCCCCAGG + Intergenic
1005955323 6:30659606-30659628 AGGCAGCCTCAATCTCCTCCTGG + Exonic
1006595445 6:35189858-35189880 AACTACCCTCACCCTATTCCTGG - Intergenic
1006982987 6:38160661-38160683 AGGTACTCTGAGCCTCCCCCAGG - Intergenic
1013294079 6:108743315-108743337 TGGTCCCCTCGCCCTCATCCAGG + Intergenic
1019595575 7:1856856-1856878 AGGCTCCCTCTCCCTCCCCCAGG - Intronic
1021969322 7:25951290-25951312 AGGTTCCCTCCGCCTCCCCCGGG + Intergenic
1022294330 7:29035772-29035794 AGGTCCACTCTCCCTTCTCCTGG + Intronic
1022985223 7:35647319-35647341 AGATAGTCCCACCCTCCTCCAGG + Intronic
1027320211 7:77005968-77005990 AGGTGCCCACCCGCTCCTCCTGG - Intergenic
1029283952 7:99453489-99453511 AGGAGCCCTGGCCCTCCTCCTGG + Intronic
1029454394 7:100660952-100660974 AGGTAACCCCTCCCTCCTCCGGG - Intergenic
1030302915 7:107992259-107992281 AATTAATCTCACCCTCCTCCAGG + Intronic
1030617852 7:111757028-111757050 TGCTACCCCCACTCTCCTCCTGG - Intronic
1030984779 7:116228926-116228948 AGGTTTCCTGACTCTCCTCCAGG + Intronic
1031510948 7:122648964-122648986 AGGTAGCCTCACCCTACTGTGGG - Intronic
1033732861 7:144195725-144195747 AGGGGCCCTGCCCCTCCTCCGGG - Intergenic
1033743711 7:144294305-144294327 AGGGGCCCTGCCCCTCCTCCGGG - Intergenic
1033750190 7:144355292-144355314 AGGGGCCCTGCCCCTCCTCCGGG + Intronic
1034213038 7:149381811-149381833 AGGCACACTCATCCTCGTCCTGG + Intergenic
1034461936 7:151202874-151202896 CTCTACCCTGACCCTCCTCCTGG + Intronic
1035521227 8:276204-276226 GGTTACCCACATCCTCCTCCAGG - Intergenic
1035542580 8:453414-453436 AGGGAACCTGACCCTCCTCGAGG - Intronic
1037624686 8:20596522-20596544 AGCTGCCCTCACTTTCCTCCAGG + Intergenic
1037822228 8:22140546-22140568 AGTTGGCCTCTCCCTCCTCCAGG - Intronic
1037865827 8:22441388-22441410 TGGTCCCCTCGGCCTCCTCCAGG - Exonic
1041778045 8:61545940-61545962 AGGTACACCCTCTCTCCTCCTGG + Intronic
1043520011 8:81034872-81034894 AGGGACCCGCTCCCTTCTCCTGG - Intronic
1048942251 8:139411377-139411399 CTGCAACCTCACCCTCCTCCGGG + Intergenic
1049838327 8:144754533-144754555 AGGTAGACTCGCCCTCCTGCAGG - Intronic
1050754731 9:8988175-8988197 TAGTACCCACACCCTCCTCTTGG + Intronic
1051355131 9:16233978-16234000 AGCTGCCCTCAGCCTCCTCTTGG - Intronic
1052904034 9:33817933-33817955 AGGTACCCTCACCCTCCTCCCGG + Exonic
1053001640 9:34579973-34579995 AGATGCCCTGACCCTCTTCCTGG - Intronic
1055373662 9:75625796-75625818 AGGTTCCCTCACACACCCCCAGG - Intergenic
1056789661 9:89617368-89617390 GGGGACCCTCACTCACCTCCAGG + Intergenic
1056831770 9:89923133-89923155 AGTGCCCCTCACCCACCTCCTGG - Intergenic
1057619406 9:96621205-96621227 AGGTCTCCTCCTCCTCCTCCAGG - Intergenic
1060056265 9:120416301-120416323 CGGTTCCCTCACCCGCCTCCTGG + Intronic
1060907907 9:127324412-127324434 AGGGACCCTCATCCTCCTTCTGG - Intronic
1061261244 9:129482225-129482247 AGGTTCCCCCGCGCTCCTCCCGG + Intergenic
1061551025 9:131334817-131334839 AGGCACCCTCTCCCTCCCACCGG - Intergenic
1061882286 9:133574379-133574401 TGGCACCCTGTCCCTCCTCCAGG - Intronic
1061912834 9:133734017-133734039 AGGTGCCCTGTCCCTCCTTCAGG + Exonic
1062111788 9:134785879-134785901 TGGAAACCACACCCTCCTCCAGG + Intronic
1062200916 9:135302158-135302180 AGGGGCCCTCACCCTCCTGGGGG + Intergenic
1186589259 X:10912465-10912487 TGGTAGTCTCACCCTCCTCCAGG + Intergenic
1188723505 X:33551809-33551831 TGGTGGCCTCCCCCTCCTCCCGG + Intergenic
1189465690 X:41276248-41276270 GGGGACCCTCAGCCACCTCCCGG - Intergenic
1195509317 X:105696304-105696326 AGGCCCCCTCACCCTAGTCCTGG - Intronic
1200236249 X:154469219-154469241 AGGTCCCCACCCTCTCCTCCTGG + Intronic