ID: 1052904040

View in Genome Browser
Species Human (GRCh38)
Location 9:33817948-33817970
Sequence CCTCCCGGACCCTGCTTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052904027_1052904040 24 Left 1052904027 9:33817901-33817923 CCCCAACACCCTCTACGAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904030_1052904040 22 Left 1052904030 9:33817903-33817925 CCAACACCCTCTACGAAGGCGGC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904032_1052904040 15 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904026_1052904040 25 Left 1052904026 9:33817900-33817922 CCCCCAACACCCTCTACGAAGGC 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904024_1052904040 26 Left 1052904024 9:33817899-33817921 CCCCCCAACACCCTCTACGAAGG 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904031_1052904040 16 Left 1052904031 9:33817909-33817931 CCCTCTACGAAGGCGGCTACTTC 0: 1
1: 0
2: 1
3: 4
4: 30
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189
1052904028_1052904040 23 Left 1052904028 9:33817902-33817924 CCCAACACCCTCTACGAAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 30
Right 1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 10
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052904040 Original CRISPR CCTCCCGGACCCTGCTTCCG CGG Intronic
900379756 1:2377973-2377995 CCTGCCGGACCCTTCTGCCTGGG + Intronic
900960949 1:5919677-5919699 CCACCCGGAACCTACTTTCGTGG + Intronic
904852016 1:33466677-33466699 CCTCCAGGACCTTGCTTTCTTGG + Intergenic
907513641 1:54980217-54980239 CCTCCAGGACCCTAGTTCCTGGG - Intergenic
910676441 1:89821154-89821176 CACCCTGGACCCTGCTCCCGCGG - Exonic
911760501 1:101608946-101608968 CCTCCCAGACCCTGGATCTGTGG + Intergenic
913192954 1:116429092-116429114 CCTCCTGGAGCTTGCTTCTGTGG - Intergenic
913608572 1:120489381-120489403 CCTGCCGGACACTGCTGGCGGGG - Intergenic
914416789 1:147491358-147491380 CCTCTAGGACCATGCTTCTGTGG + Intergenic
914582629 1:149032457-149032479 CCTGCCGGACACTGCTGGCGGGG + Exonic
919811650 1:201412489-201412511 CCACCCAGACCCTGCTCCAGTGG - Intronic
921056937 1:211549503-211549525 CCTCCCGGGACCTGCTCCGGAGG + Intergenic
921163755 1:212491194-212491216 CCTGCCTTGCCCTGCTTCCGGGG + Intergenic
922564054 1:226589750-226589772 CCTCCCTGTCCCTGCTGCAGAGG + Intronic
1062975384 10:1678844-1678866 CCTCCTGGACCCTGCTGCCTGGG + Intronic
1063220385 10:3961799-3961821 CTTCCCAGAACCTGCTTCCTGGG - Intergenic
1065535028 10:26708012-26708034 CCTCCCTGTCTCAGCTTCCGAGG + Intronic
1067697131 10:48543394-48543416 CCTCAGGGCCCCTGCTTCTGGGG + Intronic
1069996138 10:72343263-72343285 CCTCCTGCTCCCTGCTTCCTGGG + Intronic
1071309491 10:84328934-84328956 CCTCCCGTACCCGGCCTCCAGGG + Intronic
1072294250 10:93994066-93994088 CCTCCCGGGCTCTGCCTCCCGGG + Intronic
1074763887 10:116686664-116686686 CATCCCTGTCCCTGCTGCCGTGG - Intronic
1076569912 10:131425822-131425844 GGCCCTGGACCCTGCTTCCGGGG + Intergenic
1076798880 10:132811558-132811580 GCCCCCGATCCCTGCTTCCGTGG - Intronic
1076840053 10:133041394-133041416 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840062 10:133041424-133041446 CATCCCGGACCCTGCCTTCCTGG - Intergenic
1076840072 10:133041450-133041472 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840084 10:133041480-133041502 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840090 10:133041495-133041517 CATCCCGGACCCTGCCTTCCCGG - Intergenic
1076840100 10:133041521-133041543 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840112 10:133041551-133041573 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840118 10:133041566-133041588 CATCCCGGACCCTGCCTTCCCGG - Intergenic
1076840129 10:133041592-133041614 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840143 10:133041637-133041659 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840149 10:133041652-133041674 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840165 10:133041697-133041719 CATCCCGGACCCTGCCTTCCCGG - Intergenic
1076840176 10:133041723-133041745 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840186 10:133041753-133041775 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840192 10:133041768-133041790 CATCCCGGACCCTGCCTTCCCGG - Intergenic
1076840203 10:133041794-133041816 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840217 10:133041839-133041861 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840250 10:133041936-133041958 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840265 10:133041981-133042003 CTTCCCGGACCCTGCCTTCCTGG - Intergenic
1076840286 10:133042037-133042059 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1076840307 10:133042093-133042115 CTTCCCGGACCCTGCCTTCCCGG - Intergenic
1077376959 11:2209619-2209641 CCACCCTGGCCCTGCTTCCCAGG + Intergenic
1077441067 11:2569506-2569528 CCTCCAGGGCCCGGCTTCTGAGG + Intronic
1078823377 11:14905166-14905188 TCTCCCGGACCTGGCTTCCGCGG - Intronic
1079408133 11:20162945-20162967 CCACGTGGACCCTGCTTCCTGGG + Intergenic
1081986136 11:47305781-47305803 ACTCCAGTACCCTGCTTCCCTGG - Intronic
1083902949 11:65652564-65652586 CCTCCCCGACCCCGCCTCCCAGG + Intergenic
1084664890 11:70571044-70571066 CCTCCAGGACCCAGCTGCTGTGG - Intronic
1084925750 11:72510221-72510243 CCTCCCAGAGCATGCTTCCCAGG - Intergenic
1088626796 11:111735504-111735526 CCTCCCACACCTTGCTGCCGCGG - Intronic
1089302930 11:117509486-117509508 CCTCTCCAACCCTGCTTCTGGGG + Intronic
1089620939 11:119721800-119721822 GCTCCAGGACACTGCTTCCCTGG + Intronic
1089653690 11:119932023-119932045 CCTCCCGGTAGATGCTTCCGAGG - Intergenic
1090654362 11:128831657-128831679 CCTCCCTGTGCCTGCCTCCGAGG - Intergenic
1090855675 11:130607842-130607864 ACTCCAGGACCCTCCTCCCGGGG - Intergenic
1092385429 12:8032920-8032942 CCTCCCGGACCGTGCTGCCCAGG + Exonic
1097285790 12:57876227-57876249 GCTCTCGCACCCTGCTTCCCAGG - Intergenic
1101365298 12:104064815-104064837 CCGCCCGGTCACTGCTTCCTTGG + Intronic
1102475670 12:113186687-113186709 CCGGCCAGGCCCTGCTTCCGAGG - Exonic
1104814493 12:131637892-131637914 CATCCCAGGCCCTGCTTCCCAGG - Intergenic
1104983566 12:132584602-132584624 CCTCCCAGCCCCTGGGTCCGTGG + Exonic
1105932888 13:25069125-25069147 CCTCCCTGCCCCTGTTTCCACGG - Intergenic
1112212046 13:97387558-97387580 CCTCATGGAGCCTGCTTCAGAGG - Intronic
1113458419 13:110465182-110465204 CCTTCCAGAACCGGCTTCCGTGG + Intronic
1113529010 13:111006259-111006281 CCACCCGGAGCTGGCTTCCGGGG + Intergenic
1114523959 14:23356642-23356664 CCTCCCTGACTCTGCTTCTTGGG - Exonic
1115180671 14:30622249-30622271 CCTTCCGGGCTTTGCTTCCGGGG + Exonic
1119262486 14:73245848-73245870 CCTTCCTCACCCTGCTCCCGGGG + Intronic
1119552479 14:75525062-75525084 CCTCCCCGTCTCTGCTTCCCAGG + Exonic
1120342696 14:83242588-83242610 CTTCCCAGACCCTGCTTTCCTGG + Intergenic
1123053995 14:105560732-105560754 GCTCCCGGACGCTGCTCCTGGGG + Intergenic
1123078580 14:105681149-105681171 GCTCCCGGACGCTGCTCCTGGGG + Intergenic
1124923391 15:34047868-34047890 CCTCCCGCACCCTGTTTCCCAGG + Intronic
1128791094 15:70434443-70434465 CCTCTCTGAGCCTGCTTCCCTGG + Intergenic
1130397155 15:83512681-83512703 CCTCCCCGTCCCTGCCTCCCTGG + Intronic
1132752602 16:1465693-1465715 CCTGCCCAACCCTGCTCCCGAGG + Intronic
1132875795 16:2136315-2136337 CCACCCTGATCCTTCTTCCGCGG + Intergenic
1133784254 16:8963054-8963076 CCTCCCGGCCCCGGCCTGCGAGG - Intronic
1134143492 16:11742325-11742347 CCTCCCGGAACCTGCGGCCACGG - Intronic
1136382267 16:29901162-29901184 CCTCCCTGATCATGCTCCCGTGG + Exonic
1138476024 16:57271025-57271047 CCGCGTGGACCCTGCTTCCTGGG + Intronic
1139407104 16:66727753-66727775 CCTCCCCGACCCTGGGTCCTTGG + Exonic
1139493534 16:67300135-67300157 CCTTCAGGACCCTGCTCCCGTGG + Intronic
1141149113 16:81552018-81552040 CCTCCCTGCCCCTGCCGCCGAGG - Intronic
1141655409 16:85413340-85413362 CCTCCTGGACCCTCCCTCCATGG - Intergenic
1141766130 16:86061007-86061029 CCTCCCTGCCCCTTCTCCCGAGG - Intergenic
1142647493 17:1324248-1324270 CCTCCTCCGCCCTGCTTCCGGGG + Intergenic
1142647512 17:1324308-1324330 CCTCCTCCGCCCTGCTTCCGGGG + Intergenic
1142647527 17:1324359-1324381 CCTCCTCCGCCCTGCTTCCGGGG + Intergenic
1142647536 17:1324388-1324410 CCTCCTCCGCCCTGCTTCCGGGG + Intergenic
1142836993 17:2594258-2594280 CCTCCCGGGCCCGGCTTTGGGGG + Intronic
1143088429 17:4434071-4434093 CCTCCTGGAGCCTGCCCCCGTGG + Exonic
1143240397 17:5438871-5438893 CCTCGCGGACCCTGCGCCTGTGG - Exonic
1143773863 17:9185299-9185321 GCTCCCGGGCCCCGCTTCCCAGG - Intronic
1144862671 17:18315315-18315337 CAACCCGGATCCTGCTACCGCGG - Exonic
1148208032 17:45791745-45791767 CCTTCTGCACCCTGCTTCTGGGG - Intronic
1148324442 17:46775034-46775056 TCTCCCGGCCCCTCTTTCCGAGG - Intronic
1148563192 17:48618051-48618073 CTTCCCGCACCCTGCTGCCCTGG + Intronic
1151400062 17:73850207-73850229 GCTCCAGAACCCTGCTTCTGTGG - Intergenic
1152000999 17:77645158-77645180 CCTCCCGGGCTCTGCTGCAGGGG + Intergenic
1152404778 17:80090997-80091019 CCTCCCTGTCCCTTCTTCCCCGG + Intronic
1152800976 17:82330525-82330547 CCTCCAGGACCCAGCTGCTGAGG - Intronic
1154125629 18:11689706-11689728 CGGCCCGGACCCTGCTCCCTCGG + Exonic
1154348804 18:13566065-13566087 CCTCCCAGCCCCTGCTCCTGGGG + Intronic
1155152608 18:23135185-23135207 CCTCCCGCACCTGGCTTCCGCGG + Intronic
1156313484 18:35946612-35946634 CCCACAGGACCCTGCTTCTGGGG + Intergenic
1156370125 18:36465556-36465578 CCTCCCTGACACTGCTTCCAGGG + Intronic
1157257618 18:46152879-46152901 CCTCCCTGACTCAGCTTCCCAGG - Intergenic
1160140020 18:76312983-76313005 CTTCCCAGACCCTTCTTCAGCGG + Intergenic
1160919259 19:1512206-1512228 CCACCTGGACCCTGTTTCCCTGG + Intronic
1163302631 19:16457532-16457554 CCTCCAGGACCCAGCTGCCCTGG - Intronic
1167789163 19:51661128-51661150 GCTCCCGGACTCTGCTTGAGAGG - Intergenic
1168076480 19:53983004-53983026 CCTCGGGGTCCCTGCTTCGGAGG - Exonic
927679135 2:25128635-25128657 CCTCCTTGGCCCTGCTTCCAGGG - Intronic
929917458 2:46148146-46148168 ACTCCCAGCCCCTGCTTCCCAGG + Intronic
929997265 2:46836478-46836500 CCTCCCAGACTCCGCTTCCTGGG - Intronic
930284295 2:49408924-49408946 CCTCCCAGGCTCTGCTTCCAAGG + Intergenic
931322033 2:61180925-61180947 CCTGCCTGACCTTTCTTCCGTGG + Intronic
935832623 2:107016581-107016603 TCTTGCGGACCCTGCTTCCCTGG + Intergenic
938729351 2:134134309-134134331 CCTGCCAGACCTTGCTTCAGTGG + Intronic
940953820 2:159707314-159707336 CCTCCCAGACCCTCCTGCCTTGG - Intergenic
945404034 2:209423887-209423909 CCTCCCGGACACTGCGGCGGTGG + Intergenic
947592955 2:231395649-231395671 CCTGCCGGCCCCTCCTCCCGCGG + Exonic
1170136271 20:13076863-13076885 CCTCCGGGAACCTGCCTCCTGGG - Intronic
1170570312 20:17628790-17628812 CTTCCCGGCCCCTGCTCCAGAGG - Intronic
1171034194 20:21703259-21703281 GCTCGCGGACTCTGCTACCGGGG + Intergenic
1172359583 20:34302908-34302930 CCTGCCGGACCCTGCTCGGGGGG - Intronic
1172483330 20:35284591-35284613 CCTCCCGGCCCCTCCGTCCTCGG + Intronic
1175527958 20:59648573-59648595 CCTCCCTGACCCTCCATCCCTGG - Intronic
1175922661 20:62457391-62457413 CCTCTCAGCACCTGCTTCCGGGG + Intergenic
1175926940 20:62475762-62475784 CCTCCCCGACCGGGCTTCGGAGG + Intronic
1180977213 22:19855017-19855039 TCTCCCGGTCCCTGCTGGCGCGG + Intergenic
1181395267 22:22616779-22616801 CCTCCAGGACGCTGCTGCTGGGG - Intergenic
1181485892 22:23231655-23231677 CCTCCCTGACCCAGCTTGTGTGG + Intronic
1182269778 22:29146043-29146065 CCTCCGAGACCCTGCCTCCCTGG + Intronic
1183994387 22:41621737-41621759 CCTCCGGGATCTGGCTTCCGCGG + Exonic
1184403229 22:44285973-44285995 CCTCCAGGACCCTGAGTCCTTGG + Intronic
1184992533 22:48180478-48180500 CCTCCCAGACCCTCCTCCCTCGG + Intergenic
1185115093 22:48929435-48929457 CCTCCCGTTCCCTGCCTCCCAGG + Intergenic
949465507 3:4339318-4339340 CCTCCCAGAGACTGCTTCCTTGG - Intronic
950265253 3:11568683-11568705 CCTCCCGGCCACTGCTTCCCAGG + Intronic
950305852 3:11914990-11915012 ACTCCCGGACCCTGCTCTCTGGG - Intergenic
950377000 3:12580338-12580360 CCTCCAGGCCCCTGCTTGCCTGG - Intronic
951520796 3:23609258-23609280 CCTCAAGGACCCTGCCTCCTAGG + Intergenic
952301309 3:32106672-32106694 CCGCCTGGACCGTGCTTCCCTGG - Exonic
954109225 3:48424930-48424952 CCATCCAGACCCTGCTTCCTGGG - Intronic
959951687 3:112185830-112185852 AGTCCCGGGCCCTGCTTACGAGG - Intronic
967055568 3:185825897-185825919 CCTCGCGGACCGTGCTCGCGGGG + Intergenic
968405605 4:337128-337150 CCCCCAGGACCGCGCTTCCGGGG + Intergenic
968728536 4:2259297-2259319 CCTCCCGGACCCTGAGACCTGGG - Intronic
968742065 4:2336052-2336074 CCTCCCTGCCCCTGCCTCCTGGG - Intronic
969361023 4:6664025-6664047 CCTCCCTGAGCCTGCGGCCGGGG + Intergenic
970443879 4:16108339-16108361 CCTCCCCAACCCTCCTTCTGGGG - Intergenic
972386853 4:38575181-38575203 CTGCCAGGACCCTGCTTCCCTGG - Intergenic
985005915 4:185535395-185535417 CCTCCCGGGCCCTGCGCCCTGGG - Exonic
991015259 5:61925462-61925484 CCTCCAGGACCTTGCTCCCTTGG + Intergenic
993093298 5:83452787-83452809 TCTCCCAGACCCTGCCTCTGTGG + Intergenic
995224670 5:109689661-109689683 CCTCCCGGACCCAGGCTCCGCGG - Exonic
996158771 5:120136203-120136225 CCTCCCTCACCATGCTTCCTGGG + Intergenic
1002059880 5:176620018-176620040 CCTCCCCGACCTGCCTTCCGGGG + Intergenic
1002421838 5:179153106-179153128 CCTCCAGGCCTCTGCGTCCGTGG + Intronic
1004871944 6:19913876-19913898 CATCCCGGCCCCTGCATCAGTGG - Intergenic
1007279214 6:40698148-40698170 GCTCCCGGACCCTGGCACCGTGG - Intergenic
1010791977 6:80075364-80075386 ACTCTAGGACCCTGCTTCCCTGG - Intergenic
1018429533 6:163712590-163712612 CCTCCCGGGGTCTGCTTCTGGGG + Intergenic
1019276881 7:180346-180368 CTGCCAGGACCCTGCTTCGGAGG + Intergenic
1022144843 7:27526925-27526947 CACCCCAGACCCTGCTTCCTTGG - Intronic
1023059254 7:36312994-36313016 CCTCCTGGTCCCCTCTTCCGGGG - Intergenic
1023865191 7:44235093-44235115 CCTCCCGGGCCCTGCCTTCCTGG + Intronic
1030176478 7:106660376-106660398 GCCCCCGGGCCCTGCTTCGGGGG - Exonic
1031927382 7:127651723-127651745 CCTCCAGGACTCTGCCTGCGTGG + Intergenic
1034210571 7:149358879-149358901 CCCCCCGGAGCCTGCTGCCCTGG - Intergenic
1034934696 7:155191272-155191294 GCTCCCGGACCCGGCCCCCGTGG - Intergenic
1038176249 8:25184428-25184450 CCCCCGGGACCCAGCCTCCGGGG + Intergenic
1042215757 8:66428805-66428827 CCTCCCGCCCCCTGCATCCTGGG + Intergenic
1049370218 8:142260853-142260875 CCTCCCTGACCCAGCTGCAGAGG - Intronic
1049789174 8:144465287-144465309 CCTCCTGGACCCGGGTTCCCAGG - Intronic
1052904040 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG + Intronic
1053138278 9:35665244-35665266 CCTCCCCGGCCCCGCCTCCGCGG - Exonic
1056935496 9:90912581-90912603 CCTCCCAGAGCCAGCTTCCCAGG + Intergenic
1057845368 9:98518588-98518610 CCTCCCAGGCCCTGCTTTCTCGG + Intronic
1058197190 9:101992141-101992163 TCTCCCTGACCCTTCTTCAGTGG - Intergenic
1061064641 9:128269739-128269761 TCTCCCAGACCCAGCTTCCGTGG - Intronic
1061231763 9:129319675-129319697 CCTCCCGGCCCCGGCCTCCACGG - Intergenic
1061517532 9:131098279-131098301 CCACCCTCACCCTGCTTCCTGGG + Intronic
1061828244 9:133275009-133275031 CCTCCGAGACCCTGCGTCCTGGG - Intronic
1061907093 9:133704355-133704377 CCTCGCGTCCCCTGCTCCCGAGG + Intronic
1062437402 9:136552608-136552630 CCTCCCAGAGCCTGTCTCCGAGG + Intergenic
1062684066 9:137801003-137801025 CCTCCAGGACACGGCTCCCGGGG - Intronic
1187507120 X:19887198-19887220 CCGTCCGGACCCTGCCCCCGGGG + Intronic
1189438141 X:41010616-41010638 CCTCCGCGGCCCTGCTTCGGTGG + Intergenic
1189870750 X:45380814-45380836 CCTCCCTGACCCTGCTGACTAGG - Intergenic
1190057680 X:47191159-47191181 CCCCCCAAACCCTGCCTCCGAGG - Intronic
1190333657 X:49250234-49250256 CCTCCCGGACCCGGCCTAGGAGG - Exonic
1191996895 X:67105345-67105367 CCTCCCTGCCCCAGCTTCCTAGG - Intergenic
1196138929 X:112239376-112239398 CCTACTGGGCCCTGCTTCCATGG - Intergenic