ID: 1052904043

View in Genome Browser
Species Human (GRCh38)
Location 9:33817954-33817976
Sequence GGACCCTGCTTCCGCGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052904028_1052904043 29 Left 1052904028 9:33817902-33817924 CCCAACACCCTCTACGAAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 30
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1052904027_1052904043 30 Left 1052904027 9:33817901-33817923 CCCCAACACCCTCTACGAAGGCG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1052904035_1052904043 -7 Left 1052904035 9:33817938-33817960 CCCTCACCCTCCTCCCGGACCCT 0: 1
1: 0
2: 8
3: 87
4: 678
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1052904031_1052904043 22 Left 1052904031 9:33817909-33817931 CCCTCTACGAAGGCGGCTACTTC 0: 1
1: 0
2: 1
3: 4
4: 30
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1052904036_1052904043 -8 Left 1052904036 9:33817939-33817961 CCTCACCCTCCTCCCGGACCCTG 0: 1
1: 1
2: 11
3: 97
4: 982
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1052904030_1052904043 28 Left 1052904030 9:33817903-33817925 CCAACACCCTCTACGAAGGCGGC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1052904032_1052904043 21 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052904043 Original CRISPR GGACCCTGCTTCCGCGGCCG AGG Intronic
900112445 1:1014172-1014194 GGACCGTGCTGCCGGGGCCCAGG - Exonic
900991987 1:6102353-6102375 GGAACCAGCTGCCGAGGCCGAGG + Exonic
901007962 1:6180651-6180673 AGACCCTGCCTCCGCGCCCTTGG - Intergenic
901222157 1:7589317-7589339 GAACCCTGCCACAGCGGCCGGGG - Intronic
902518804 1:17004449-17004471 GCACACTGCTTCTGGGGCCGGGG - Intronic
905356673 1:37389757-37389779 GGAACCTGCTCCCACGGCTGTGG + Intergenic
906126887 1:43432373-43432395 GGAGCCTTCTTCAGCGGCCTGGG + Exonic
907579330 1:55557512-55557534 GGACCCTGTTTCTGCAGCCAGGG + Intergenic
920665374 1:207959413-207959435 GGACCCTGCAGACCCGGCCGCGG + Intergenic
924564607 1:245186334-245186356 GGACCCTGCTTCCGTAACCTTGG + Intronic
1067753244 10:48985576-48985598 GGACTCTGCTTCCGATGCCTCGG - Intergenic
1076060489 10:127410403-127410425 GTAACCTGCCTCCGCGGTCGGGG - Intronic
1076525877 10:131112187-131112209 GGTCTCTGCTTCCAGGGCCGGGG + Intronic
1076749713 10:132536820-132536842 GGACCCTGGGTCTGAGGCCGCGG - Intergenic
1077407317 11:2388459-2388481 GGGCCCTGCTTCCCTGGCCAGGG + Intronic
1078823373 11:14905160-14905182 GGACCTGGCTTCCGCGGACTGGG - Intronic
1083808290 11:65087957-65087979 TGACCCTGCTCCAGCGGGCGGGG + Exonic
1083844227 11:65321597-65321619 GGACCCTGACTCCGCCGCCAGGG - Exonic
1085037501 11:73308961-73308983 GGCCGCTTCTTCCGCGGCCGCGG - Exonic
1091550204 12:1530737-1530759 CGACTCTTCATCCGCGGCCGGGG - Intronic
1101606004 12:106248031-106248053 GGGGCCTGCCTCCGCCGCCGCGG + Intronic
1103521290 12:121538049-121538071 GGGCCCCGCGTCCTCGGCCGGGG - Intronic
1103703101 12:122858161-122858183 GGGCGCTGCTGCCGAGGCCGCGG + Exonic
1107053325 13:36075997-36076019 GGAGCCTGCTTCCGTTGCCCAGG - Intronic
1114623545 14:24114070-24114092 GCACCCTGGACCCGCGGCCGGGG + Intronic
1121525902 14:94619119-94619141 CGACCCTGCTTCCGCAGCAGTGG - Intronic
1122913358 14:104844415-104844437 GGGCCCTGCTTCCTCTGCCTGGG + Intergenic
1123077705 14:105677423-105677445 GGTCCCTGCTCCTGCGGCGGTGG + Intergenic
1128866042 15:71115749-71115771 CGACCCGGCTTCCGCTGCCCAGG + Intronic
1129803945 15:78438519-78438541 AGCCCCAGCTTCCGCGGCCTAGG - Intronic
1132934822 16:2474990-2475012 GGCCCCAGCTTCCGCCGCTGCGG + Intergenic
1136261726 16:29082074-29082096 GGCCCCGCCTTCCGGGGCCGGGG + Intergenic
1137708064 16:50548796-50548818 GGGCCGTTCTGCCGCGGCCGCGG - Intronic
1141860365 16:86712286-86712308 GCACCCTGCTTCCCCTCCCGTGG + Intergenic
1144687933 17:17238316-17238338 GGAGCCTTCCGCCGCGGCCGAGG + Intergenic
1145866865 17:28247361-28247383 GGGCCCTGCTTCCGGGGCATAGG + Intergenic
1147425756 17:40345249-40345271 GGGGCCTTCTTCCGCTGCCGCGG + Intronic
1147539717 17:41346997-41347019 AGACCCTGCCTCCGGGGCCCTGG + Intronic
1147541666 17:41365328-41365350 AGACCCTGCCTCCGGGGCCCTGG + Intronic
1147545140 17:41395398-41395420 AGACCCTGCCTCCGGGGCCCTGG + Intronic
1155152611 18:23135191-23135213 GCACCTGGCTTCCGCGGCCCCGG + Intronic
1160140023 18:76312989-76313011 AGACCCTTCTTCAGCGGCTGAGG + Intergenic
1160745251 19:708523-708545 GGACCCTGCGAGCGGGGCCGGGG + Intergenic
1160837780 19:1132714-1132736 GGACTTTGCTTCGGCGGCAGGGG - Intronic
1163607140 19:18281576-18281598 GGGCGCTGCGGCCGCGGCCGGGG - Exonic
1163666515 19:18606333-18606355 GAGTCCTGCTTCCGCGCCCGAGG - Intronic
1163784128 19:19265926-19265948 GGTCCCTACTTCCCTGGCCGGGG + Intronic
1166230650 19:41424369-41424391 GGACCCTGCTTCCTCCTGCGGGG - Intronic
1166306799 19:41940073-41940095 GGACCCTGACTCCGCGGCCCCGG + Intergenic
1166882929 19:45940174-45940196 GGCCGCTGCAGCCGCGGCCGGGG - Exonic
929486691 2:42361216-42361238 GGACCCCGCCTCCCCGGCTGTGG + Exonic
937093852 2:119223639-119223661 GGACGCTGCCACCGCTGCCGGGG + Intergenic
944412823 2:199459227-199459249 GGACCCGGCCTCCCCGCCCGGGG + Intronic
946185641 2:217979011-217979033 GCCCCCTGCCTCCCCGGCCGCGG - Intronic
946354605 2:219176977-219176999 GGCCCCGCCTTCCGCCGCCGGGG - Intronic
948449475 2:238060520-238060542 TGGCCCTGCTGCCGCGGCCCCGG + Intronic
948808253 2:240462142-240462164 GGACCATGTTTCCCCCGCCGTGG - Intronic
1170998693 20:21391798-21391820 GCACCCTCCTTCCTCGTCCGCGG + Intergenic
1174429283 20:50456203-50456225 GGGCCCTGCCTCCAAGGCCGTGG + Intergenic
1175423825 20:58852207-58852229 GCACCCTGCTTGCGCCGCTGTGG + Intronic
1175426365 20:58869891-58869913 GGACCCAGCTTCCCCTCCCGTGG - Intronic
1176550033 21:8217047-8217069 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176568960 21:8400082-8400104 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1176576874 21:8444317-8444339 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1178610252 21:34073571-34073593 GGACCGTGCTTTCGCCGCCTGGG + Exonic
1179529916 21:42011062-42011084 GGACCCGGCGGCCGCGGCCAGGG + Intergenic
1180040750 21:45278254-45278276 GGTCTCTGCTTCCTCGGCCCGGG - Intronic
1180363526 22:11920074-11920096 GTAGCCTGCTGCCGAGGCCGAGG + Intergenic
1180609019 22:17084086-17084108 GGCGACAGCTTCCGCGGCCGTGG + Intergenic
1182047784 22:27289199-27289221 GGACACTGCTTCCGATGCTGGGG - Intergenic
1182243578 22:28936554-28936576 GGCCCCTGCTTCCTGGGCCCAGG + Intronic
1184046873 22:41977285-41977307 GGTCCCTGCTTGCGTGTCCGTGG - Intronic
1184136630 22:42553801-42553823 GGGCCCTGCTCCCACAGCCGCGG - Intronic
1184502615 22:44883024-44883046 GGACCCTGCTTACACAGCCTGGG - Exonic
1184562136 22:45269340-45269362 GGACCCTGCTCTCCCGGCCCCGG + Intergenic
1185224720 22:49645956-49645978 GGACCCTGCTTCCATGACCAGGG - Intronic
1203254923 22_KI270733v1_random:133373-133395 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203262979 22_KI270733v1_random:178452-178474 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
952866686 3:37860177-37860199 GGACAGGGCTTCTGCGGCCGAGG - Intergenic
954889653 3:53913455-53913477 GGGCCCTGCTTGGGAGGCCGAGG - Intergenic
961513897 3:127420975-127420997 GGACCCTGCTTCCCCCTCCGGGG - Intergenic
963511196 3:146251144-146251166 GGACCCTCCTTCCCCGCGCGCGG + Exonic
972386851 4:38575175-38575197 GGACCCTGCTTCCCTGGCTATGG - Intergenic
975131880 4:70839549-70839571 GGACGCGGCGGCCGCGGCCGCGG + Exonic
978795795 4:112706162-112706184 GGCCCCGCCTTCCGGGGCCGGGG - Intergenic
985679685 5:1249420-1249442 GGACCCCGCTGCCACGGCCAGGG + Intergenic
991900608 5:71456000-71456022 GGACTCTGCTTCCAAGCCCGCGG + Exonic
994096690 5:95853661-95853683 GGACCCTGCTGCTGGGGCTGTGG + Intronic
1001773463 5:174312197-174312219 GGTCCCGGCTTCTGCGGCCCAGG + Intergenic
1002808735 6:604663-604685 GGACCCTGCTTCCTGGGCTGCGG + Intronic
1003402019 6:5798288-5798310 GGGCCCTGCTTCCTCTGCGGTGG - Intergenic
1011984068 6:93419715-93419737 GGACCCCGCCCCCGTGGCCGGGG - Intergenic
1013793562 6:113859936-113859958 GGCCTCTCCCTCCGCGGCCGTGG - Exonic
1017819238 6:158037814-158037836 GGAGCCAGCATCCGCGGCCCAGG - Intronic
1021716976 7:23469729-23469751 CGGCTCTGCTTCCCCGGCCGGGG - Intronic
1021958740 7:25852389-25852411 CGACCCTGCTTCCCAGGCCCCGG + Intergenic
1024579873 7:50793089-50793111 GGGCCCGGCGTCCCCGGCCGCGG + Intronic
1027267995 7:76504516-76504538 GGACTCTGCTTCTGCAGCGGAGG + Intronic
1028762340 7:94509924-94509946 GGAACCTGACCCCGCGGCCGCGG - Exonic
1032090802 7:128910593-128910615 GGACTCACCTTCCGCGCCCGCGG + Exonic
1033654044 7:143361830-143361852 CGGCCCTGCCTCGGCGGCCGGGG - Intronic
1034128908 7:148698568-148698590 GGGCGCCCCTTCCGCGGCCGAGG - Intronic
1034174769 7:149091309-149091331 GGACCCCGCCTCCGCGTCCCCGG - Intergenic
1034781528 7:153886670-153886692 GGCCTCTGCATCCGCCGCCGCGG - Intergenic
1034964346 7:155382383-155382405 GGTCCCTGCTTGCGGGTCCGGGG + Intronic
1038038073 8:23703035-23703057 GCACCCTGGTCCCGCCGCCGAGG + Exonic
1039377139 8:37045732-37045754 GGGCCCTGCTTCCTAGGCAGAGG - Intergenic
1042367411 8:67952678-67952700 GGACTCTGCGTTCGCGGGCGCGG + Intronic
1045277737 8:100722329-100722351 GGGCTCCGCTTCCCCGGCCGCGG - Exonic
1049007269 8:139863446-139863468 GGACACTGCTTCCTCTGCTGGGG + Intronic
1049476079 8:142797537-142797559 GGACCCTGCTGCCCCGGGTGGGG + Intergenic
1049812310 8:144580967-144580989 TGACGCTGCTGCCGCGCCCGGGG + Exonic
1052904043 9:33817954-33817976 GGACCCTGCTTCCGCGGCCGAGG + Intronic
1060700939 9:125748016-125748038 GGCGCCGGCTCCCGCGGCCGCGG + Intronic
1061309535 9:129753131-129753153 GGGCCCTGCTGCCGCTGCCGTGG - Intergenic
1061510762 9:131059671-131059693 GGACCCTGCTTCCTCCACAGGGG - Intronic
1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG + Intergenic
1062414262 9:136439825-136439847 GGACCCAGCAACCGCCGCCGCGG + Intergenic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203471325 Un_GL000220v1:116519-116541 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203479146 Un_GL000220v1:160491-160513 GGACCGTGCCCCCGCCGCCGGGG - Intergenic
1203546527 Un_KI270743v1:132562-132584 GTAGCCTGCTGCCGAGGCCGAGG - Intergenic
1197854759 X:130902962-130902984 GGAGGGTGCTTCCGGGGCCGCGG - Intronic
1198767130 X:140091456-140091478 GGATGCTGCCTTCGCGGCCGCGG - Intergenic