ID: 1052904046

View in Genome Browser
Species Human (GRCh38)
Location 9:33817961-33817983
Sequence GCTTCCGCGGCCGAGGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052904032_1052904046 28 Left 1052904032 9:33817910-33817932 CCTCTACGAAGGCGGCTACTTCA 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904039_1052904046 -10 Left 1052904039 9:33817948-33817970 CCTCCCGGACCCTGCTTCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904031_1052904046 29 Left 1052904031 9:33817909-33817931 CCCTCTACGAAGGCGGCTACTTC 0: 1
1: 0
2: 1
3: 4
4: 30
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904035_1052904046 0 Left 1052904035 9:33817938-33817960 CCCTCACCCTCCTCCCGGACCCT 0: 1
1: 0
2: 8
3: 87
4: 678
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904036_1052904046 -1 Left 1052904036 9:33817939-33817961 CCTCACCCTCCTCCCGGACCCTG 0: 1
1: 1
2: 11
3: 97
4: 982
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904037_1052904046 -6 Left 1052904037 9:33817944-33817966 CCCTCCTCCCGGACCCTGCTTCC 0: 1
1: 0
2: 4
3: 57
4: 570
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98
1052904038_1052904046 -7 Left 1052904038 9:33817945-33817967 CCTCCTCCCGGACCCTGCTTCCG 0: 1
1: 0
2: 1
3: 23
4: 317
Right 1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052904046 Original CRISPR GCTTCCGCGGCCGAGGCCTC CGG Intronic
900630271 1:3631432-3631454 GCTGCCACGTCCGTGGCCTCGGG + Intronic
902916816 1:19644485-19644507 GCCCCCGCGGCCGAAGCCTCTGG - Intronic
906376950 1:45303771-45303793 GCTTCCGGGGCCGCCGCCTCTGG + Intronic
914213962 1:145607893-145607915 GCTCCCGCCGCGGAGGCCCCAGG - Intergenic
914465906 1:147928296-147928318 GCTTCCGCCGCGGAAGCCCCAGG - Intergenic
918240324 1:182615113-182615135 TCTTCCGGGGCCGAGGGCTGCGG - Intergenic
921692248 1:218164858-218164880 TCCTCCGCGGCCGGGGCCTGGGG + Intergenic
922518238 1:226223842-226223864 GCTTCCTCGGCCGGGACCCCGGG + Exonic
923372592 1:233328065-233328087 GCTCCCCCGGCCGAGGACACCGG - Exonic
1067068228 10:43115405-43115427 GGCTCCAGGGCCGAGGCCTCAGG - Intronic
1070302098 10:75210966-75210988 GCCGCCGCGGCCTAGGCCCCTGG - Intronic
1071835733 10:89415228-89415250 GGGTCCGCGGCCGCCGCCTCCGG + Intronic
1077385824 11:2269111-2269133 GCTTCCGGGGCTGAGGCTGCGGG + Exonic
1083419671 11:62545906-62545928 GCTGCGGCGGCCCAGTCCTCGGG - Intronic
1088738311 11:112746654-112746676 GCTTTCCCGGCCCAGGCCTTTGG - Intergenic
1089374724 11:117986296-117986318 GGTTCCCCGTCCGCGGCCTCGGG + Intergenic
1091659750 12:2374517-2374539 CCTTCCGTGGGCCAGGCCTCAGG + Intronic
1092228937 12:6766417-6766439 GCTACCGCGGCCGAGCGCGCCGG + Exonic
1092518437 12:9240407-9240429 GCCTCCGCCGCCGCGGACTCCGG - Intergenic
1094025763 12:25958680-25958702 GCTCCCGCGGCCGGTGCCTCTGG - Intergenic
1094199149 12:27779890-27779912 GCGTCCGCAGCCGAGGCGCCCGG + Intergenic
1097708573 12:62894233-62894255 ACTTCCGTGGCAGAGGCCCCAGG + Intronic
1100971728 12:100078318-100078340 GCTTCTGGGGAGGAGGCCTCAGG - Intronic
1104692647 12:130838807-130838829 GCTTCCTGGGCGGAGTCCTCAGG - Intronic
1105896124 13:24718612-24718634 TCTGCCGGGGCCGTGGCCTCCGG - Intergenic
1108095019 13:46892564-46892586 GCTTGCTCGGCAGAGGCCACCGG + Exonic
1112319661 13:98395110-98395132 TCTCCCGCCGCAGAGGCCTCGGG + Intronic
1112344101 13:98576547-98576569 GCTCCGGCGGCCGAGGTCTCCGG - Intronic
1113055257 13:106260472-106260494 GCTTCGGCAGACGTGGCCTCAGG - Intergenic
1122985920 14:105211586-105211608 GTGTCCTCGGCCGAGGCCTATGG - Intronic
1123457190 15:20436907-20436929 GCTTCCGGGACAGAGGCCCCTGG + Intergenic
1123660868 15:22563452-22563474 GCTTCCGGGACAGAGGCCCCTGG - Intergenic
1124263346 15:28212056-28212078 GCTTCCGGGACAGAGGCCCCTGG + Intronic
1124314670 15:28657690-28657712 GCTTCCGGGACAGAGGCCCCTGG - Intergenic
1128565867 15:68700111-68700133 GCCTCGGTGGCCGATGCCTCAGG - Intronic
1128992401 15:72272202-72272224 GCTTCCCCGGGAGAGGCCTCAGG - Intronic
1130234048 15:82117892-82117914 GCTTCTGCTGCTGAGTCCTCTGG - Intergenic
1132555452 16:570069-570091 GCTTCCGGGGCCGCGCGCTCGGG - Exonic
1132685045 16:1158700-1158722 GCTTCTGCGGCCGGGGCTGCCGG + Intronic
1135135226 16:19882438-19882460 GCTTACGGGGCCGTGGGCTCCGG + Intronic
1139424856 16:66873322-66873344 GCATTTGCGGCCGAGGCTTCAGG - Intergenic
1142764294 17:2056973-2056995 GCGGCCGCGGCCGTGGCCCCGGG + Exonic
1149461402 17:56833217-56833239 GCTTCCGCGTCCGCGTTCTCCGG + Exonic
1151854408 17:76710792-76710814 GCGCCCCCGGCCGAGGCCACCGG - Exonic
1152210629 17:79001317-79001339 ACTTCAGCAGCCGAGGCCCCTGG + Intronic
1152600598 17:81260300-81260322 GCTTCCTCTGCCAAGTCCTCGGG + Exonic
1155507566 18:26548196-26548218 TCCTCCCCGGCCGAGTCCTCGGG + Intronic
1160768788 19:821372-821394 GCTGCCCCGGCAGTGGCCTCGGG - Intronic
1160998167 19:1894603-1894625 GCTTCGCAGGCAGAGGCCTCAGG + Intergenic
1161894473 19:7069833-7069855 GTTTCCGCCCCTGAGGCCTCGGG + Intronic
1163586950 19:18169342-18169364 GCTCCCGCCGCCGCAGCCTCCGG - Exonic
1163612773 19:18309730-18309752 GCCTCCGCGGCCGCGGCCCTTGG + Exonic
1165824303 19:38697053-38697075 GCTTCTGCCACTGAGGCCTCAGG - Intronic
1166108969 19:40611359-40611381 GCTTCCGCTCCCGAGGGCCCGGG + Exonic
1166539331 19:43595115-43595137 GCTTCCGCCGCCCAGGGCCCCGG + Exonic
1166688340 19:44809042-44809064 GCTGCCGGGGGCGGGGCCTCTGG + Intronic
926759461 2:16265021-16265043 GCTTCCCCTGCTGAGGCCTCTGG - Intergenic
927847613 2:26479594-26479616 CCTTCCGGGGCCGAGGCCGCTGG + Exonic
928347284 2:30511930-30511952 GCTTCCGCCTCCTAGGCCTTAGG + Intronic
937689826 2:124742976-124742998 GCTTCCGGGGCCTGGGGCTCTGG - Intronic
938093997 2:128449948-128449970 CCTTCAGAGGCCCAGGCCTCTGG + Intergenic
938727295 2:134120151-134120173 GCTCCCGCGGCGGCGGCCCCGGG + Intronic
941104916 2:161341172-161341194 GCGCCCCCGGCCGAGGCCACCGG - Intronic
944412848 2:199459316-199459338 ACTCCCGCGGCCGCGGCCGCCGG + Intronic
1171481633 20:25459562-25459584 GCTGCCGCCGCCCAGGCCTGCGG + Intronic
1172543612 20:35742044-35742066 GGTTCCGCGGCCTGGGCCTAGGG - Intronic
1173672869 20:44810285-44810307 GCCGCCGCGGCCGAGGCGCCCGG - Intronic
1180733708 22:18000871-18000893 GCCTCCGCGGCCTGGCCCTCGGG - Intronic
1185185947 22:49400359-49400381 GCTTCCCCGGCCTGGGCCTGGGG + Intergenic
1185383123 22:50519261-50519283 GCCTTGGGGGCCGAGGCCTCAGG - Exonic
952476761 3:33718214-33718236 GCTTCAGAGGCCGCGGCCGCGGG + Intronic
952866684 3:37860170-37860192 GCTTCTGCGGCCGAGGCAGGTGG - Intergenic
952905457 3:38136923-38136945 ACGTCCGCGGCCGAGGCCTGCGG + Exonic
955656439 3:61250232-61250254 GCCTCCGCGGCCAAGGCCTCAGG + Intronic
956414702 3:69013670-69013692 GCTCCCGCGCCCGAGGTTTCCGG - Exonic
956720825 3:72115932-72115954 GCTTCTGTGGCTGAGGCCTACGG - Intergenic
961213279 3:125141706-125141728 GCTGCCGCGGCGGGGGCTTCCGG + Intronic
961252606 3:125519917-125519939 GCCTCCTCGGCCGAGCCCACTGG + Intronic
961426372 3:126851663-126851685 GCTTCCCAGGCCTAGGCCCCAGG - Intronic
968470817 4:781571-781593 GCTTCCGAGGCCTCGGCTTCGGG + Intergenic
968471862 4:786202-786224 CCTTCGGCGGCCCTGGCCTCGGG + Exonic
969660852 4:8526604-8526626 CCTCCCGCAGCCCAGGCCTCAGG + Intergenic
985679241 5:1247285-1247307 GCTTCCCCTGCCGTGGGCTCAGG - Intergenic
985679265 5:1247367-1247389 GCTTCCCCTGCCGTGGGCTCAGG - Intergenic
985679275 5:1247407-1247429 GCTTCCCCTGCCGTGGGCTCGGG - Intergenic
985848568 5:2371961-2371983 GCTTCTGAGGCCCAGGCCTTGGG + Intergenic
992820121 5:80488014-80488036 TCTTCCCCCGCCGAGGCCTGTGG + Exonic
997400192 5:133596249-133596271 GCTTCAGGGGCCCAGGCCCCTGG + Intronic
1002888205 6:1313543-1313565 CCTTCCGCAGCCGCCGCCTCAGG + Exonic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1017954946 6:159169684-159169706 GCCTCCTCGGCGGCGGCCTCAGG + Exonic
1019198822 6:170297269-170297291 GCTTCCACGGCCGCGCTCTCCGG - Intronic
1022715267 7:32892296-32892318 GCCGCGGCGGCCGAGGCCTTGGG + Intronic
1024526641 7:50355012-50355034 GCTTCTGAGGCAGAGTCCTCAGG + Intronic
1034253937 7:149714489-149714511 GTTTCCCCGACCGCGGCCTCTGG + Intergenic
1034342733 7:150368721-150368743 GCTCCCGCGGCCGCGGCCTGGGG - Intronic
1039377136 8:37045725-37045747 GCTTCCTAGGCAGAGGCCTGAGG - Intergenic
1039716048 8:40110316-40110338 GCTTCCGCAGCCCAGACCTGAGG + Intergenic
1040928784 8:52713762-52713784 GCTTCCTCGGCCGGAGCCTTGGG - Intronic
1043428469 8:80171572-80171594 GCCGCCGCGCCCGACGCCTCTGG - Intronic
1045565485 8:103310376-103310398 GCTTCCGGGGCTGAGGCCTGAGG - Intronic
1049460806 8:142726894-142726916 ACCTCCGCGGCCGAAGCCGCGGG - Intergenic
1052904046 9:33817961-33817983 GCTTCCGCGGCCGAGGCCTCCGG + Intronic
1057619193 9:96619681-96619703 GCTGGCGCGGCCGAGGCGACGGG + Exonic
1061262234 9:129486785-129486807 GCTTCCTCTCCCGAGTCCTCTGG + Intergenic
1061484479 9:130913432-130913454 GCTCACGCGGCAGACGCCTCGGG - Intronic
1061779108 9:132985248-132985270 GCTTCCCCTGCAGAGCCCTCTGG - Intronic
1203778082 EBV:85275-85297 CGTTCCCCGGCAGAGGCCTCGGG + Intergenic
1203778104 EBV:85335-85357 CGTTCCCCGGCAGAGGCCTCGGG + Intergenic
1200161351 X:154011489-154011511 GCGTCTGCAGCCCAGGCCTCTGG - Exonic