ID: 1052915448

View in Genome Browser
Species Human (GRCh38)
Location 9:33921738-33921760
Sequence CCACGTGGGCAACTGTTTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052915448_1052915454 11 Left 1052915448 9:33921738-33921760 CCCTGAAACAGTTGCCCACGTGG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1052915454 9:33921772-33921794 TAGAATGGAGATGTGTTGCTTGG 0: 1
1: 0
2: 3
3: 13
4: 183
1052915448_1052915453 -4 Left 1052915448 9:33921738-33921760 CCCTGAAACAGTTGCCCACGTGG 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1052915453 9:33921757-33921779 GTGGTTCAAGACAACTAGAATGG 0: 1
1: 1
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052915448 Original CRISPR CCACGTGGGCAACTGTTTCA GGG (reversed) Exonic
900146162 1:1159685-1159707 CCACCTGGGCAGCTGTGTCCTGG - Intergenic
903031973 1:20470207-20470229 CAACGTGTGCAACTGTATCCTGG - Intergenic
905230459 1:36511984-36512006 CCACGTGAGAAACTCTTTGAGGG + Intergenic
907260014 1:53211060-53211082 CCAGCTGGGCAACTGCGTCAGGG - Exonic
911157390 1:94650967-94650989 GAACTTGTGCAACTGTTTCATGG + Intergenic
1075940360 10:126386258-126386280 CCAAGTAGGCAACTGTGCCAGGG + Intronic
1077375012 11:2201687-2201709 CCAGGTGGGCCAGGGTTTCAGGG - Intergenic
1079376701 11:19899373-19899395 GGACGTGGGCAACTTTTCCATGG - Intronic
1083537325 11:63481560-63481582 CTAAGTGGGCACCTGTTTCCGGG - Intronic
1084672075 11:70613065-70613087 CCACGTGGGAGAATGTGTCAGGG + Intronic
1084712549 11:70852970-70852992 CCACGTGGCCCACTGGTTCAGGG - Intronic
1086460356 11:86999631-86999653 CCACCTGTGCTGCTGTTTCAAGG - Intergenic
1089119657 11:116124673-116124695 CCACGTGGGCCTCTGGTTCTGGG + Intergenic
1090502055 11:127270620-127270642 CCACGTGGGAAACAGATTCAAGG + Intergenic
1091017549 11:132066280-132066302 CCACCTGAGGAACTGTTCCAAGG + Intronic
1093156213 12:15688885-15688907 CCCCGTGGGCGAGTGTTACAGGG - Intronic
1093966508 12:25332441-25332463 CCAGGTGTGCAACTGTATTAAGG + Intergenic
1101098654 12:101369870-101369892 CCTTGTGGTCAATTGTTTCAAGG + Exonic
1122138146 14:99646219-99646241 CCAAGTGGGCAAATGTTGCCTGG + Intronic
1123206643 14:106719985-106720007 CCACAAAGGAAACTGTTTCATGG + Intergenic
1129066772 15:72911726-72911748 CAATCTGGGCATCTGTTTCAAGG + Intergenic
1130128728 15:81117908-81117930 CCACCTGGGCATCTGAGTCAGGG + Intronic
1131262898 15:90897837-90897859 CCAAATGGGCAAATGTTTCAGGG - Intergenic
1132171189 15:99657580-99657602 CCAGATGGGCAAATGATTCAGGG - Intronic
1132203054 15:99968327-99968349 CCACATCGGCACCTGATTCAGGG + Intergenic
1141730698 16:85821127-85821149 TCACCTGGGCGACTGTTTCAAGG + Intergenic
1141820788 16:86444177-86444199 CCACGTGGCCCACTGTTTTCAGG - Intergenic
1143893674 17:10120783-10120805 CCACGTGGGAAGCTGTTGGAGGG - Intronic
1148868704 17:50642917-50642939 CCACTTTGGCAACAGGTTCAAGG - Intronic
1149102918 17:52927818-52927840 CCACGTGGGCATGTGTTACAGGG + Intergenic
1153948499 18:10037555-10037577 CCACGTAGACATCTGTCTCAAGG + Intergenic
1156744634 18:40374147-40374169 CCACCTGAGAAATTGTTTCATGG - Intergenic
1159676764 18:71294363-71294385 ACACGTGGGGACCTGTTGCAGGG - Intergenic
1160808806 19:1004140-1004162 CCACCTGGGGAACTATCTCAGGG + Intronic
1164744521 19:30601378-30601400 TCACGTGGGCAGCAGATTCATGG + Intronic
1166427395 19:42691780-42691802 CCACATGGGCAAGTGCTTCCAGG - Intronic
1166449262 19:42884255-42884277 CCACGTGGGCAAGTGCTTCCAGG - Intronic
1166453670 19:42922489-42922511 CCACATGGGCAAGTGCTTCCAGG - Intronic
1166465931 19:43031044-43031066 CCACGTGGGCAAGTGCTTCCAGG - Intronic
1166472070 19:43087113-43087135 CCACGTGGGCAGGTGCTTCCAGG - Intronic
1166483215 19:43191068-43191090 CCACATGGGCAAGTGCTTCCAGG - Intronic
1166485683 19:43210160-43210182 CCACGTGGGCAGGTGCTTCCAGG - Intergenic
1166492845 19:43274097-43274119 CCACATGGGCAAGTGCTTCCAGG - Intergenic
1167533484 19:50033548-50033570 CCACTGGGACGACTGTTTCAGGG + Intronic
932093560 2:68827563-68827585 CCTCCTGGGCAACTGGGTCAGGG - Intergenic
933204274 2:79487389-79487411 CCACTTAGGCCACTGATTCAAGG - Intronic
937951106 2:127388302-127388324 CCACGTGGGAGACCTTTTCACGG - Exonic
939076824 2:137612917-137612939 CCACCTGGGTGACTGTTACAAGG - Intronic
943824588 2:192372907-192372929 CCACATTGGCATCTGTTTCTTGG + Intergenic
948808738 2:240464398-240464420 CCACGTGTGCACCTGTGCCACGG - Intronic
1172037543 20:32020313-32020335 CCAAGTGAGGAAGTGTTTCAAGG - Intronic
1180934228 22:19613847-19613869 CCACGTGGCCATCTGTTACGTGG + Intergenic
1182283968 22:29233235-29233257 CCACCTGGGCACCTGCTCCAGGG - Intronic
1182994743 22:34801705-34801727 CCCCGTGGGCATTTGTTACAGGG - Intergenic
1183028642 22:35085443-35085465 CCACGTGGGCCCCTGTCACAAGG - Exonic
1184347221 22:43921393-43921415 CCAGCTGGGCAAGGGTTTCATGG - Intergenic
1185344227 22:50304407-50304429 CCAGGAGGGCCACTGTGTCAGGG + Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950500683 3:13361689-13361711 ACACATGGGCAGCTGTTTGAAGG - Intronic
951507959 3:23469967-23469989 CCATGTTGGCAAATATTTCAAGG + Intronic
952467823 3:33609596-33609618 CCAGGTGAGCATCTGTTTAAGGG - Intronic
966553708 3:181233961-181233983 CCACGTGGGTAAAGGTTGCAAGG + Intergenic
966912528 3:184567336-184567358 CCACATGGGCCACTCTTGCAAGG - Intronic
968656900 4:1782610-1782632 CCGCCTGGGCAGCTGCTTCAGGG + Intergenic
988397635 5:30715124-30715146 CCAACTGGGCAAATGTTTCTAGG + Intergenic
989134164 5:38136580-38136602 CCAGCTGGGCAGCTGTTTCCAGG - Intergenic
989538438 5:42590876-42590898 CCAGCTGTGCAATTGTTTCAGGG + Intronic
1008290859 6:49714026-49714048 CCCCGTTGGCAACAGTTTTATGG + Intergenic
1016714829 6:147212815-147212837 CAATGTGAGCTACTGTTTCAAGG - Intronic
1017166326 6:151411562-151411584 CTAAGTGGTCAGCTGTTTCATGG - Intronic
1017338275 6:153287783-153287805 GGACTTGGGCAATTGTTTCATGG - Intergenic
1019841774 7:3453310-3453332 CCACCAGGGCAACTTATTCAGGG - Intronic
1029603164 7:101581889-101581911 CCACGTGGCCTCCTGTTTCTAGG - Intergenic
1035131195 7:156655431-156655453 CCACGTGGGAAATTGTTACAGGG - Intronic
1039889853 8:41678029-41678051 ACACGTGAGCAACTCTATCAGGG - Intronic
1045521050 8:102903727-102903749 CAACATGGGCAACTGTTGAAGGG + Intronic
1047411103 8:124625340-124625362 CCACGTGAGCAAGGGTTTCTTGG + Intronic
1050074197 9:1846830-1846852 GCACCAGGGGAACTGTTTCATGG + Intergenic
1051637857 9:19197204-19197226 CCAGGGGGGCAACTGTTTAAAGG + Intergenic
1052915448 9:33921738-33921760 CCACGTGGGCAACTGTTTCAGGG - Exonic
1055671816 9:78614983-78615005 CCAACTGGGCGACTGTTTGAGGG - Intergenic
1057872346 9:98727858-98727880 CCCCTTGGGCAACTTTATCAGGG + Intergenic
1058205401 9:102099983-102100005 CCACGTTGGCACCTATTTCCTGG + Intergenic
1199447638 X:147944381-147944403 CCACCATGGCAACTGCTTCAGGG - Intronic