ID: 1052917232

View in Genome Browser
Species Human (GRCh38)
Location 9:33932754-33932776
Sequence GTGGGGATAAGGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 642}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052917232_1052917248 25 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917248 9:33932802-33932824 GACGGGAATGACTCGCCATGAGG 0: 1
1: 0
2: 0
3: 0
4: 27
1052917232_1052917235 -8 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917235 9:33932769-33932791 ATCCCCACAGAGCCCAGTGATGG 0: 1
1: 0
2: 1
3: 25
4: 221
1052917232_1052917241 0 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917241 9:33932777-33932799 AGAGCCCAGTGATGGGGTCCTGG 0: 1
1: 0
2: 2
3: 39
4: 374
1052917232_1052917249 30 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917249 9:33932807-33932829 GAATGACTCGCCATGAGGTCTGG 0: 1
1: 0
2: 1
3: 5
4: 67
1052917232_1052917242 3 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917242 9:33932780-33932802 GCCCAGTGATGGGGTCCTGGTGG 0: 1
1: 0
2: 3
3: 34
4: 281
1052917232_1052917238 -6 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917238 9:33932771-33932793 CCCCACAGAGCCCAGTGATGGGG 0: 1
1: 1
2: 3
3: 29
4: 289
1052917232_1052917246 8 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917246 9:33932785-33932807 GTGATGGGGTCCTGGTGGACGGG 0: 1
1: 0
2: 1
3: 12
4: 233
1052917232_1052917236 -7 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917236 9:33932770-33932792 TCCCCACAGAGCCCAGTGATGGG 0: 1
1: 1
2: 0
3: 17
4: 223
1052917232_1052917245 7 Left 1052917232 9:33932754-33932776 CCATCCTCATTCCTTATCCCCAC 0: 1
1: 0
2: 5
3: 83
4: 642
Right 1052917245 9:33932784-33932806 AGTGATGGGGTCCTGGTGGACGG 0: 1
1: 0
2: 3
3: 31
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052917232 Original CRISPR GTGGGGATAAGGAATGAGGA TGG (reversed) Intronic
900029473 1:360418-360440 GTGGGGATAGCCAATGAGCAGGG - Intergenic
900033276 1:386584-386606 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
900050075 1:589191-589213 GTGGGGATAGCCAATGAGCAGGG - Intergenic
900054114 1:616473-616495 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
901876303 1:12168730-12168752 GTGGGGAGCAGGGATGAGGGAGG - Intronic
902165943 1:14571808-14571830 CTGGAGCTAAGTAATGAGGATGG + Intergenic
902512103 1:16972129-16972151 ATGGGGATAAAGAATGGGGGTGG + Intronic
902728039 1:18350274-18350296 GTGGGGAGCAGGAGTGAGGGTGG + Intronic
902786528 1:18735906-18735928 GGTGGGAGAAGGAATGGGGACGG - Exonic
903169309 1:21542241-21542263 GTGGGCATGAGGAATGAGGCAGG - Intronic
903172020 1:21560289-21560311 CTGGGTAGAAGGAATGAGCATGG + Intronic
903350516 1:22713728-22713750 GAGGAGACAAGGAAGGAGGAAGG - Intronic
903695145 1:25200957-25200979 GGGAGGATAAGGCAGGAGGATGG - Intergenic
904696421 1:32334310-32334332 GTGGGGACAGGGAAGGAGGTAGG + Exonic
904888195 1:33757714-33757736 ATGGAGATAAGGAATGAAGGAGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906378948 1:45319343-45319365 GTGGGGGAAAGGATTTAGGATGG - Intergenic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906615062 1:47228368-47228390 TTGGGGAGAATGAAGGAGGAGGG + Intronic
906879752 1:49577110-49577132 TTGGGGACAAGGTATGTGGATGG + Intronic
907170175 1:52455666-52455688 GGGGGGAGAGGGAAGGAGGAAGG + Intronic
907893061 1:58654348-58654370 GTGGAGGTAAGGAGTGAGAATGG - Intergenic
908376960 1:63553203-63553225 GTGGAGATAAGGAAGGATCATGG + Intronic
909040570 1:70644765-70644787 GTGGGGAGAAGGAAAGGAGAGGG - Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909988561 1:82192912-82192934 GTGGGGACAAGGACTGAGTGGGG - Intergenic
910234579 1:85022641-85022663 GAGGGGATAAGGAATGGGTATGG + Intronic
910737037 1:90470747-90470769 GTGAGAAGAAGGTATGAGGAAGG + Intergenic
911043065 1:93607287-93607309 ATGGGGACCAGGAATGAGCATGG + Intronic
911090608 1:94014248-94014270 GAGGGCAGAAGGAAAGAGGAAGG + Intronic
911665115 1:100543070-100543092 GTGGGGCTGAGGAAGGGGGAAGG + Intergenic
912582368 1:110732248-110732270 GTGATGATTAGGAATGGGGATGG + Intergenic
912757069 1:112333388-112333410 TTGGGGAGAAGGAAAGTGGAAGG - Intergenic
912830035 1:112944795-112944817 GTGGGGCTTAGGTATGAGAATGG - Intronic
913243921 1:116854984-116855006 GTGGGGAGAAGGAAGGAGTGTGG - Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
915281730 1:154827393-154827415 GTGAGATTGAGGAATGAGGAAGG - Intronic
916794214 1:168150777-168150799 GTGTGAACAAGGAATGAGCAAGG - Intergenic
917030842 1:170689713-170689735 GTGGCGATATGGAGTGAGGTGGG + Intronic
917266308 1:173224272-173224294 GTGTGGGTAAGTGATGAGGAAGG + Intergenic
917661606 1:177182025-177182047 GTGCGGAGAAGGAATGGGGAGGG + Intronic
917735434 1:177915798-177915820 GTGGGGGTGAGGCAGGAGGAGGG - Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918128872 1:181607798-181607820 GTGGAGATTAGGAATGAGGCTGG + Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918256859 1:182756479-182756501 ATGGGGATAAAGAATGAAGATGG + Intergenic
918457107 1:184732323-184732345 GTGGGGATGGGGAATAGGGAGGG + Intronic
919162793 1:193853386-193853408 GAGGGGAGCAGGAAAGAGGATGG - Intergenic
919770163 1:201153659-201153681 GTGCGGGTGAGGAGTGAGGAAGG - Intronic
920057408 1:203202586-203202608 ATGGGAATGAGGAATGAGCAGGG - Intergenic
921512639 1:216050966-216050988 GGGAGGATAAGGACTGAGGAAGG - Intronic
921637623 1:217514489-217514511 GTTGGGATAGAGAATAAGGATGG + Intronic
921682639 1:218052579-218052601 GTGTAGCTAAGAAATGAGGAAGG + Intergenic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
921856194 1:219987534-219987556 GTGGTGATAAGGTTTGAGGGAGG + Intronic
922077692 1:222264138-222264160 GTGGAGATAAACCATGAGGAAGG - Intergenic
922225269 1:223640563-223640585 GTGAGGAAAAGGAATCAGAATGG - Intronic
922255635 1:223890738-223890760 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922640196 1:227222392-227222414 GTGTGGCTGAGGCATGAGGAAGG + Intronic
923009352 1:230075775-230075797 ATGGGGATTAGGGATGAGGGCGG + Intronic
923546027 1:234923825-234923847 CTGGGGATGAGGAATGAGATGGG - Intergenic
924005131 1:239600709-239600731 GAGGGAAGAAGGAAGGAGGAAGG - Intronic
1062933124 10:1365490-1365512 GTAGGGAGAAGGCATGATGATGG + Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063548710 10:7007595-7007617 GTAGGGATAAAGAAGGAGGAAGG - Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1064139890 10:12781469-12781491 GTGAGGCTAAGGAACGGGGAGGG - Intronic
1065083193 10:22147509-22147531 GTGAGGAGAAGGAACTAGGAGGG - Intergenic
1065387902 10:25151712-25151734 GGTGGGGTAAGGTATGAGGATGG - Intergenic
1065632590 10:27695685-27695707 GGAGAGATAAGGGATGAGGAAGG + Intronic
1067023989 10:42827594-42827616 GTGGGGATAAGGAAGCAAGAGGG - Intronic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1069251276 10:66270307-66270329 GTGGGGCTGAGGCAGGAGGATGG - Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072683842 10:97525392-97525414 GTGTGGCTGAGGAATTAGGAGGG + Intronic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073911219 10:108347047-108347069 GAGGGGAGAGGGAAAGAGGAGGG + Intergenic
1075179596 10:120197925-120197947 GAGGGGATAAGGAAGGAGTGGGG - Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1075645218 10:124092470-124092492 GCGGGGAGGAGGAAGGAGGAGGG + Intronic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075984075 10:126768133-126768155 GTGTGTATATGGAATGATGATGG - Intergenic
1076238655 10:128884976-128884998 GAAGGGATCAGGCATGAGGAAGG - Intergenic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1076989831 11:267288-267310 GTGGGGAGAAGTGAGGAGGAGGG + Intergenic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077207902 11:1352952-1352974 GTGGGGATGAGGGGTGAGGGTGG - Intergenic
1077420798 11:2448996-2449018 GTGGGGACAGGGGATCAGGAGGG + Intronic
1077801531 11:5543686-5543708 GTGAGGAGAGGGAATGAGGGTGG - Intronic
1078462603 11:11526027-11526049 GTGGGGGAAAGGTATGAGAAAGG + Intronic
1078488745 11:11749516-11749538 GTGGGGATAATGACTGAGAGGGG + Intergenic
1079128629 11:17735267-17735289 GCGGGGAGAAGGAACGAGGAGGG + Exonic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079226291 11:18608442-18608464 GGGGGGATTAGGAAGTAGGAGGG - Exonic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1080369660 11:31620293-31620315 GTGAGGATAAGGATTGACCATGG + Intronic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080812331 11:35717008-35717030 GCAGTGATAATGAATGAGGAGGG + Intronic
1080965011 11:37204326-37204348 GTGGGGATGAGGAAGAAGTAGGG - Intergenic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1081935053 11:46898531-46898553 GTGGGGAAATGGAATTAGGTTGG - Intronic
1081983996 11:47288574-47288596 GTGGGGTCAGGGTATGAGGATGG - Intronic
1082868417 11:57920592-57920614 TTGGGGCTGAGGAATGAGCAAGG + Intergenic
1083186111 11:61018862-61018884 GTGGGGAAAATGGATGTGGACGG + Intronic
1083308628 11:61773424-61773446 GGAGGGAGTAGGAATGAGGAGGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084301192 11:68253796-68253818 GGGAGGATAAGGCAGGAGGATGG - Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084760264 11:71266362-71266384 GAGGGGATGAGGAAGGAGCAGGG - Intergenic
1084767972 11:71324838-71324860 GTGGGGAGCAAGAATGAGGCAGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1086495706 11:87402533-87402555 ATGGGGATCAGGAATCAGGGAGG + Intergenic
1087638789 11:100733388-100733410 GTAGGGCTAAGAAATGAGAAAGG + Intronic
1087650233 11:100857831-100857853 GAAGTGATAAGGAACGAGGACGG - Intronic
1088110487 11:106255560-106255582 GTGGGGCTTAGAGATGAGGATGG - Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088741815 11:112773790-112773812 TTGGAGATAAGGAGTGATGATGG + Intergenic
1088880679 11:113971114-113971136 GGGGCGATAAGGGAAGAGGAAGG + Intergenic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089375005 11:117987982-117988004 GTGGGGATCAGGTGTGTGGATGG + Intronic
1089913700 11:122129961-122129983 GTGGGGAGAAGGAATAAAGAGGG + Intergenic
1090644804 11:128758751-128758773 GAGTGGAGAAGGGATGAGGAAGG + Intronic
1091051830 11:132379388-132379410 TTGGGGAAAAGGTATGTGGAAGG + Intergenic
1091460598 12:641437-641459 GTGGGGAGAGGCCATGAGGATGG + Intronic
1092145880 12:6214449-6214471 GGGGGGCTGAGGAAGGAGGATGG - Intronic
1092403718 12:8200011-8200033 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093432414 12:19098937-19098959 GTGGGGCTAAGGCAGGAGGATGG - Intergenic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1094631585 12:32180660-32180682 GTGAGGATTAGGAAAGAAGAAGG - Intronic
1095140108 12:38651429-38651451 TTGCGGAAAAGGAATGAGGCAGG + Intronic
1095286059 12:40411730-40411752 TTGGGGCTTAGGAATGGGGAAGG + Intronic
1095857079 12:46872168-46872190 GTTGGAATAAGAAATGATGATGG - Intergenic
1095860705 12:46914832-46914854 GGGGAGATAAGAAGTGAGGATGG + Intergenic
1097382881 12:58916681-58916703 GTGGGGTTAATGAATGGGAAAGG + Intronic
1097509505 12:60519514-60519536 GTGGGGATGAGGGATGGAGATGG + Intergenic
1098097167 12:66970679-66970701 GTGGTGGTAAGGAGTGGGGAAGG + Intergenic
1098530986 12:71541677-71541699 GTGAGGATAAAGCATGATGATGG - Intronic
1099366019 12:81766016-81766038 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1099426396 12:82529007-82529029 GTGGATATAAGGAATGATTAAGG - Intergenic
1100313017 12:93414766-93414788 GTGGGGATAGGGAGTGTGCAGGG - Intronic
1100437488 12:94584866-94584888 ATGGGGATAGGGAATAAAGAAGG + Intronic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1101000329 12:100351541-100351563 GTTGGGATAAGGAATAGGGTTGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102242998 12:111337068-111337090 GGGAGGATAAGGCAGGAGGATGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102771365 12:115480092-115480114 GTGAGGATAAGGAATGACTGGGG + Intergenic
1102807438 12:115794319-115794341 GTAGAAATAAGGAATAAGGATGG + Intergenic
1102839530 12:116103355-116103377 GTGGGGCCAAGGCAGGAGGATGG - Intronic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103377073 12:120465367-120465389 GTGGTGAGAAGGAAAGATGATGG - Intronic
1103397471 12:120619143-120619165 GAGGGGCTAAGGAAGGAGGAGGG - Intergenic
1103862171 12:124024220-124024242 GAGGAGATCAGGAATGGGGAAGG - Intronic
1104275860 12:127327196-127327218 GTGTGTAGAAGGAAAGAGGAAGG + Intergenic
1104930131 12:132334356-132334378 GTGGAGTTCAGGAATGAGGGTGG + Intergenic
1105274688 13:18908748-18908770 GTGGGCATAAGAAATTAGTAGGG + Intergenic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1106603535 13:31207808-31207830 GTGGAGAGAAGTAGTGAGGAAGG - Intronic
1107025870 13:35800819-35800841 GGGAGGCTGAGGAATGAGGATGG - Intronic
1107035944 13:35902556-35902578 GTAGGCATCAGGAATGATGAAGG + Intronic
1107332809 13:39319856-39319878 GTGGTGACAAGTAATGAAGAGGG + Intergenic
1107748894 13:43543128-43543150 ATGGGGACATGGAATGGGGAAGG + Intronic
1107752529 13:43584209-43584231 GTGGGAATAAGGAAAGAAGTCGG + Intronic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1108202776 13:48059113-48059135 GTGGGGATAACTAAAAAGGAGGG - Intronic
1109326473 13:60873309-60873331 GTGTGGATAGGGAAAGAGGTTGG + Intergenic
1109519114 13:63485433-63485455 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1109918111 13:69018409-69018431 GTTGAGATAAGGACTGAGAAAGG - Intergenic
1110236321 13:73221407-73221429 GTGGGGAAAAGGATTGCAGAGGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110411932 13:75214294-75214316 AGAGGGATGAGGAATGAGGAGGG - Intergenic
1111520666 13:89399046-89399068 CTGGGGGTTAGGGATGAGGAAGG - Intergenic
1112015186 13:95325604-95325626 GAAGGGAGAAGGAAGGAGGAAGG + Intergenic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113357169 13:109591850-109591872 CTGGGGATAAGGAAGGTGTAGGG + Intergenic
1113536886 13:111075206-111075228 GTGAGGACAAGGCAGGAGGATGG - Intergenic
1114301058 14:21378460-21378482 GTGGGGAAAAGTTATGAAGAAGG + Intronic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114613252 14:24055518-24055540 GTGGGGATATGGAAGGGGGCAGG - Intronic
1115250571 14:31342145-31342167 GTGGGGCTGAGGCAGGAGGATGG + Intronic
1115322533 14:32099118-32099140 GTGAGGATAATGAATGAGATGGG + Intronic
1115993055 14:39169596-39169618 CTGAGCATTAGGAATGAGGAAGG + Intronic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118753005 14:68820094-68820116 GTGGGAATCGGGTATGAGGATGG + Intergenic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119870101 14:78009580-78009602 GGTGGGATAGGGAATGAGAAAGG - Intergenic
1119875812 14:78058232-78058254 GAGGTGATAAGGAAGGAGAAAGG - Intergenic
1119950406 14:78738675-78738697 GTGGGGAAAAAGAATGGGGTGGG - Intronic
1119973695 14:79001640-79001662 TTTGGGATAAGGCATGAGTATGG - Intronic
1120199398 14:81519794-81519816 TTTGGGCAAAGGAATGAGGAAGG + Intronic
1120305494 14:82764449-82764471 GTAGGGAGAAGGAAAGAGTAAGG - Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1121063003 14:90933851-90933873 GTGGGGTTATGGAATGAGTGAGG - Intronic
1121449114 14:93996535-93996557 GTGGGGGCCAGGAATGAGGGAGG - Intergenic
1121502987 14:94453262-94453284 GTGGAGCTAAGCTATGAGGATGG - Intergenic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1122090848 14:99339152-99339174 GTGGTTATAATGAATGAGGATGG + Intergenic
1122236315 14:100332522-100332544 TTGGGGATGAGGCATGAGGCCGG - Intergenic
1122797403 14:104212880-104212902 GTGGGCAAAAGGCATGAGGCTGG + Intergenic
1123217539 14:106825741-106825763 GTGGTGATAAGGGAGGAGGTGGG - Intergenic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1126878198 15:53066727-53066749 GTGGGGTTAAGTACTGAAGAAGG - Intergenic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128326242 15:66725952-66725974 GTGGGCAGGAGGACTGAGGAAGG - Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128744640 15:70104734-70104756 GTTGGGATGGGGAATGGGGAGGG + Intergenic
1129589916 15:76905630-76905652 GTGGTGATAAGGCAGGAGGAGGG - Intergenic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1129800171 15:78407821-78407843 GTGGTGCTGAGAAATGAGGAAGG - Intergenic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1131747874 15:95469221-95469243 GTGGGGATGAGGAAGGAGCACGG + Intergenic
1132855541 16:2043021-2043043 GGGGAGGTAAGGACTGAGGAGGG - Intronic
1133321211 16:4914849-4914871 GGGGGGTTAGGGAATGAGGGAGG - Intronic
1133480973 16:6170165-6170187 GTGAGGCTATGGCATGAGGAAGG + Intronic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133681823 16:8126926-8126948 GAGGGGATAAGGATCCAGGAGGG + Intergenic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133981699 16:10637436-10637458 GAGGGGAGGAGGAAGGAGGAGGG + Intronic
1135010870 16:18877442-18877464 GTGGGGAGAGGGAACGAGGAAGG + Intronic
1135317757 16:21465027-21465049 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135370652 16:21896826-21896848 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1135441134 16:22473893-22473915 GTGGGGAGAGGGAACGAGGAAGG - Intergenic
1135939393 16:26808239-26808261 CTGGGGATAACGAATCAGAAAGG - Intergenic
1136187725 16:28597848-28597870 GTGAGGACAAAGAACGAGGAGGG - Intergenic
1136314528 16:29444709-29444731 GTGAGGAGAGGGAACGAGGAAGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136327970 16:29546477-29546499 GTGGGGAGAGGGAACGAGGAAGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136442655 16:30286478-30286500 GTGAGGAGAGGGAACGAGGAAGG + Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137511996 16:49108899-49108921 GTGGGGAGGAGGAAGGATGATGG - Intergenic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138479124 16:57290175-57290197 GTGGGGATAAGGTCAGAGCAGGG - Intergenic
1138984082 16:62305624-62305646 GTGGGCAGAGGGAATGGGGAAGG + Intergenic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1141051223 16:80766064-80766086 TTGGAGCTAAGGGATGAGGAGGG + Intronic
1143249648 17:5513736-5513758 GTGGGGATAAGATAGGAGGTTGG + Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143526827 17:7478006-7478028 GAGGGGATTTGGTATGAGGAAGG - Intronic
1143728839 17:8868403-8868425 GAGGGGATAAAGCATGAGGTTGG - Intergenic
1144278791 17:13703335-13703357 GCGGGGAGAGGGAGTGAGGAAGG + Intergenic
1144333196 17:14243205-14243227 GAGGGGAGAAGAAAGGAGGAGGG + Intergenic
1144610004 17:16702712-16702734 GGGGGAATAAAGAATGTGGAAGG + Intronic
1144902740 17:18612704-18612726 GGGGGAATAAAGAATGTGGAAGG - Intergenic
1144928321 17:18833274-18833296 GGGGGAATAAAGAATGTGGAAGG + Intergenic
1145056452 17:19706804-19706826 GTGGGGAGCAGGAATGAGGTGGG - Intronic
1145129827 17:20334041-20334063 GGGGGAATAAAGAATGTGGAAGG + Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146220735 17:31017463-31017485 ATGGGAATCAGGAATGAGAAAGG - Intergenic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1147004597 17:37392259-37392281 TTGGGGATAACTTATGAGGAAGG - Exonic
1147700317 17:42389692-42389714 TTGGGGAGAAGGAATGATGGGGG - Intergenic
1148718410 17:49732510-49732532 GATGGGATAAGGGATAAGGATGG - Intronic
1148899348 17:50865083-50865105 GTGGGGATAAGAAAAGATCAAGG + Intronic
1149294452 17:55249334-55249356 GAGTGGGGAAGGAATGAGGAAGG - Intergenic
1149624260 17:58068576-58068598 GAGGGGGTAAGAAATGAGGCTGG + Intergenic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1149888390 17:60363855-60363877 TTTGGGAGAAGGAAGGAGGAAGG + Intronic
1150194102 17:63276677-63276699 GTGGGGATAAAAAAGGGGGAAGG - Intronic
1150367039 17:64597899-64597921 ATGGGAATCAGGAATGAGAATGG + Intronic
1150558741 17:66276841-66276863 GTGGGGTTAAGCAATGAGTGGGG + Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151173908 17:72271153-72271175 GTGGGGATACTGAATGCAGAGGG - Intergenic
1151371384 17:73648334-73648356 GTGGGTACAAGGCGTGAGGAGGG - Intergenic
1152310481 17:79546971-79546993 GTGGGTCTAAAGAATGAGGAAGG - Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152950284 17:83226138-83226160 GTGGGGATAGCCAATGAGCAGGG + Intergenic
1153089802 18:1330790-1330812 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1153544966 18:6195970-6195992 GAGGGGATGAGGAATGAAGAGGG - Intronic
1153879160 18:9405289-9405311 GTGGGGATAAGACATGAGACAGG - Intergenic
1153952455 18:10068852-10068874 GGAGGGGTAAGGAGTGAGGATGG + Intergenic
1154031245 18:10756062-10756084 ATGGGGATAAGGATAAAGGATGG + Intronic
1154406809 18:14099218-14099240 GTAGAGATAAGTATTGAGGAGGG - Intronic
1154466375 18:14646006-14646028 GTGGGCATAAGAAATTAGTAGGG + Intergenic
1155201215 18:23519411-23519433 GTGGGGCTAAGGCTGGAGGATGG + Intronic
1155379746 18:25207037-25207059 TTCGGGATAATGAATGGGGAAGG - Intronic
1155385751 18:25275642-25275664 ATGGGGAGAAGGAAAGAGGGAGG - Intronic
1155416694 18:25606206-25606228 CTGTTGATAAGGAATGACGAGGG - Intergenic
1155531618 18:26772576-26772598 GTGGGGACAAAGAATAAGGTTGG + Intergenic
1157524992 18:48373854-48373876 GGGGGGCTAAGGAAGGAGAATGG + Intronic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157684560 18:49631870-49631892 GTGGGGATTATGGATGAGGTGGG - Intergenic
1157992433 18:52512947-52512969 GTGGAGAGAAGAAATGAAGATGG + Intronic
1158175352 18:54650278-54650300 GTAGGGGTGAGAAATGAGGAAGG + Intergenic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160392625 18:78546814-78546836 GAAGGGATAAAGAATGAGAAAGG + Intergenic
1160527339 18:79545404-79545426 GAGAGGATGAGGAATGAGGCTGG + Intergenic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1162389377 19:10380226-10380248 GTGGGGACGAGAAAGGAGGAAGG - Intronic
1163092675 19:15031806-15031828 GCAGGGAGAAGGAAGGAGGAAGG + Intergenic
1164592189 19:29513121-29513143 GGGGGGATAAGGAGGAAGGAGGG + Intergenic
1164855453 19:31517372-31517394 GTGGGAAGAAGGAAGAAGGAGGG + Intergenic
1165066485 19:33232143-33232165 TTGGGGATAGGAACTGAGGAGGG + Intergenic
1165431575 19:35776075-35776097 GTGGGGCTCGGGAATGAGAAAGG - Intronic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1166075849 19:40413400-40413422 GGGGGGAAAAGGAATGGGGAGGG + Intergenic
1166204465 19:41259983-41260005 GTGGGGATAAGGCGTGGGGTGGG - Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1167055050 19:47105134-47105156 GTGGTGGGAAGGAATGAGGAGGG - Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168271229 19:55250854-55250876 GTGGGGAGAGGGAACGAGCAGGG - Intronic
1168452707 19:56478208-56478230 GCGGGGAGAAGGGACGAGGAGGG + Intergenic
1168615688 19:57835159-57835181 ATGGGGTTAAGGGAGGAGGAAGG + Intronic
1168621095 19:57880289-57880311 ATGGGGTTAAGGGAGGAGGAAGG - Intronic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
925869932 2:8261302-8261324 GTGGTGAGATGGAATGAGAAAGG + Intergenic
927257477 2:21052580-21052602 GTGGGGATGCGGAGTAAGGATGG + Intergenic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928950507 2:36809159-36809181 GTAGGGAGAAGGAACAAGGATGG + Intronic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929769513 2:44879893-44879915 GTGGGGAGAAGGAGTTAGAAAGG - Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
930759902 2:55022615-55022637 GTAGGTAGAAGAAATGAGGAAGG - Intronic
931152814 2:59593969-59593991 GTGGGGAAATGGAAGGTGGAGGG + Intergenic
931282694 2:60808010-60808032 TTGGGGAAAAGGTATGAGGCTGG + Intergenic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
933751678 2:85606434-85606456 GTGGCAGTAAGCAATGAGGATGG + Intronic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
934704659 2:96468531-96468553 GTGGGGAGAAGGAAGGGGAATGG - Intergenic
934904939 2:98191911-98191933 GTGGAGGTAAGGAAAGAGTATGG - Intronic
935266193 2:101396248-101396270 GTTAGGATAGGGGATGAGGATGG - Intergenic
935571520 2:104666144-104666166 GAGGGGATGAGGAAAGATGAAGG - Intergenic
936047827 2:109200735-109200757 GTGGGCATGAGGGGTGAGGAGGG - Intronic
936971044 2:118176585-118176607 GTGGGGAGAAGGAGCAAGGAGGG - Intergenic
937060530 2:118977588-118977610 GTGGGGCTGTGGAAAGAGGATGG - Intronic
937216567 2:120316995-120317017 GCGGGGCTTAGGAATGGGGAGGG - Intergenic
937435733 2:121879644-121879666 GTGGTGGTAAGGAGTGGGGAAGG + Intergenic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939106289 2:137952328-137952350 GTGGGAAGAAGGAATTAGGGAGG + Intergenic
939558701 2:143708541-143708563 GTGGGGATTGGGTATGAGAATGG - Intronic
939788593 2:146545480-146545502 TTGGGGAAAAGGTATGTGGATGG - Intergenic
940270076 2:151880936-151880958 CATGGAATAAGGAATGAGGAAGG + Intronic
940539337 2:154990367-154990389 GAGGGGATAAGGTGTAAGGAAGG - Intergenic
940861851 2:158778877-158778899 CTGGGGATTAGGAAAGAGGTTGG + Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
942326812 2:174782760-174782782 GTAGGAATAAGGAATGAGGTTGG + Intergenic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
943202771 2:184850083-184850105 GTGGGGGTAAAAAGTGAGGATGG + Intronic
945001924 2:205360973-205360995 GGGAGGGAAAGGAATGAGGAAGG - Intronic
945015213 2:205508081-205508103 GTAGGGATAGTGAAAGAGGAGGG + Intronic
945015397 2:205509610-205509632 GTAGGGATAGTGAAGGAGGAGGG + Intronic
945071070 2:205989485-205989507 CTGAGCATAAGGAATGTGGAAGG - Intergenic
945465305 2:210162607-210162629 GTGGGTATAAGCAAAGAGAAAGG + Intronic
945590918 2:211730456-211730478 GAGGAGATAGGGAAAGAGGAAGG - Intronic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
946083914 2:217151824-217151846 GTGTGGATATGGGATGGGGATGG + Intergenic
946426646 2:219601966-219601988 GCTGGGACAAGGAAAGAGGAGGG - Exonic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946706357 2:222462231-222462253 GTCAGGTTAAGGAATGAGCAGGG + Intronic
947648971 2:231768267-231768289 GTTGGAGTCAGGAATGAGGAAGG - Intronic
947824157 2:233092889-233092911 GTGGGGCTGAGGAATGAAGATGG - Intronic
947859341 2:233347849-233347871 GTGGGGAGAAGGAATGTAGTGGG + Intergenic
948720081 2:239893964-239893986 GCAGGGAGAAGGAATGAGGCTGG - Intronic
948720111 2:239894093-239894115 GCAGGGAGAAGGAATGAGGCTGG - Intronic
948720166 2:239894350-239894372 GCAGGGAGAAGGAATGAGGCTGG - Intronic
948720177 2:239894396-239894418 GCAGGGAGAAGGAATGAGGCTGG - Intronic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169226138 20:3858185-3858207 TGGGGGAGAAGAAATGAGGAAGG - Intronic
1169428479 20:5514268-5514290 GTGGGGATAAGGAAAGTGGAAGG + Intergenic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1169700689 20:8443463-8443485 GTGTGGAAAAGAAATGAGCAGGG + Intronic
1170345961 20:15387489-15387511 GGGGGGAAAAGGAATGGAGAAGG - Intronic
1173300052 20:41794474-41794496 TTGGGGAGAAGGAAGGAGGGAGG - Intergenic
1173926511 20:46785025-46785047 GTGGGGATCGGGTATTAGGAGGG + Intergenic
1174891132 20:54395735-54395757 GTGGAGAGATGGAATCAGGATGG + Intergenic
1175017914 20:55811603-55811625 GTGGGAGGTAGGAATGAGGAGGG - Intergenic
1175062786 20:56258927-56258949 GTGGAGAGAAGAAATGAGGAGGG + Intergenic
1175805325 20:61825081-61825103 GTGGGGTGAAGGAATGAAGGAGG - Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176808213 21:13512595-13512617 GTGGGCATAAGAAATTAGTAGGG - Intergenic
1177208050 21:18033293-18033315 GTAGGGATAAGGACAGAGGCAGG + Intronic
1177861705 21:26462247-26462269 GTGGTGGCAAGGGATGAGGAGGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178683011 21:34689025-34689047 GTGGGGTGAGGGAATGAGGTGGG + Intronic
1178970382 21:37169963-37169985 TTTGGTATAAGGAATGAGGTAGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179474422 21:41634220-41634242 GCCGGGAGAAGGAAGGAGGAGGG - Intergenic
1180012257 21:45058731-45058753 ATGGGGACATGGAATGGGGAGGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1182250489 22:28996176-28996198 GGGAGGCTAAGGAAGGAGGATGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182526418 22:30923149-30923171 GAGGGGACAAGAAAAGAGGAGGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183394624 22:37564255-37564277 GTGGGGGTGGGGAATCAGGAAGG + Intronic
1184611550 22:45607107-45607129 CTTGTGATAATGAATGAGGAAGG + Intergenic
1184694260 22:46131028-46131050 GTGGGGATAGGACATGAGGCAGG + Intergenic
1185000514 22:48242680-48242702 GTGGGGATGGGGCATGTGGAGGG - Intergenic
1185066036 22:48632191-48632213 GTGGCGGTAAGGGTTGAGGACGG - Intronic
949147941 3:726187-726209 GTGGGGACTAAGAATGAGAAAGG + Intergenic
949219521 3:1614250-1614272 GTGGGGATAAGGTTTGAGTAGGG - Intergenic
949342299 3:3043213-3043235 GTGGGGATAAGGAATAAACTTGG - Intronic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950104466 3:10379415-10379437 GTGGGGATACGGGTTGGGGAGGG + Intronic
950507677 3:13405626-13405648 GAGGGTATAAGAAATGAGAAGGG + Intronic
950599585 3:14020805-14020827 GTGGGTGGAAGGTATGAGGAGGG - Intronic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
952470493 3:33645245-33645267 CTGGGTATAAGGAATAAGGCAGG - Intronic
953042944 3:39271075-39271097 TTGGGAAAAAGGAATGGGGAAGG - Intronic
953315437 3:41922599-41922621 GTGGGGTTAAGGGGTGAGGGGGG + Intronic
954264075 3:49459830-49459852 GAGTGAATAAGGAAAGAGGAGGG - Intergenic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954622800 3:52005425-52005447 GTGGGGATAAGAGAAGGGGATGG + Intergenic
954749152 3:52804010-52804032 GTGGGGATAGGGATGGAGGCCGG + Intronic
955374891 3:58386662-58386684 GAGGGTATAAGGACTGAGGCAGG - Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957968230 3:87348981-87349003 GGGGGGAAAAGGAATCAGAACGG + Intergenic
958182966 3:90083783-90083805 GTGGGGATAACTAAAAAGGAGGG - Intergenic
958774718 3:98468162-98468184 GGGAGGAAAAGGAATGTGGACGG - Intergenic
960293893 3:115919122-115919144 GTGGGGGTGAGGAGTGGGGAGGG - Intronic
960558870 3:119059886-119059908 TTAGGGATAAGGAAAGAAGAAGG + Intronic
960722943 3:120642409-120642431 CTGGGCATGTGGAATGAGGAGGG + Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
960968796 3:123124431-123124453 GTTGGGGGAAAGAATGAGGAAGG + Intronic
961243623 3:125433415-125433437 TTAGGGAAAAGGAATGAGGCTGG - Intergenic
962100434 3:132336301-132336323 GTGTGGAGAATGAATTAGGATGG + Intronic
962426225 3:135271428-135271450 GTGGGGAAAGGCAATGAGGCTGG - Intergenic
962536741 3:136335618-136335640 GTGAGGCTAAGGTAGGAGGATGG - Intronic
962653506 3:137519177-137519199 GTGGGGTTAAGGGATGAGGGTGG + Intergenic
962675975 3:137759017-137759039 GTTGAGATAATGAATGAGTAAGG + Intergenic
962991432 3:140580894-140580916 GTGGGGAGAAGGAACCAGAATGG + Intergenic
963058139 3:141204315-141204337 GTGGTGATAATGAAGGAGGGAGG + Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
965526525 3:169725319-169725341 GTGGGGAGGAGGAATGGTGATGG - Intergenic
966445776 3:179999189-179999211 TTGGGGAAAAGGTATGTGGATGG + Intronic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
967389893 3:188945348-188945370 GTGGGGAGAAGGGTTCAGGATGG - Intergenic
968002831 3:195219490-195219512 AAGGGAAGAAGGAATGAGGAAGG + Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968466181 4:752568-752590 TTGTGGATAAGGAGTGAGGTGGG + Intronic
968652501 4:1765846-1765868 GTGGGGAGAAGGGAGGAGGGAGG + Intergenic
968982878 4:3860158-3860180 GTGGGGTGAATGAATGAGAAGGG - Intergenic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970558562 4:17260085-17260107 GAGGGGGCAAGGAATGATGATGG + Intergenic
970979715 4:22082078-22082100 GTGGTGAGAGGCAATGAGGAGGG + Intergenic
971119855 4:23691116-23691138 GAGGGGATTGGGAAAGAGGAGGG + Intergenic
971273879 4:25176987-25177009 GTGGGGCTGAGGCAGGAGGATGG - Intronic
971393747 4:26209758-26209780 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971393765 4:26209807-26209829 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
971510401 4:27417049-27417071 ATTTGGATAAGTAATGAGGAGGG + Intergenic
971767007 4:30845702-30845724 GGGAGGCTAAGGAGTGAGGATGG - Intronic
972027806 4:34408821-34408843 ATAGGGATTAGGAATTAGGAAGG - Intergenic
972047711 4:34689261-34689283 GTGGTGCTAAGGAGTTAGGAAGG + Intergenic
973595006 4:52479020-52479042 GTGGCAATAGGGAAAGAGGAAGG - Intergenic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
973919186 4:55667354-55667376 GAGGAGACAAGGAAAGAGGAAGG + Intergenic
973992075 4:56419089-56419111 CTGGGGATGAGGGATGAGGCAGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
975462901 4:74675260-74675282 GTGGGGCTAGAGAAAGAGGATGG + Intergenic
975738005 4:77400498-77400520 GAGGGGATAAAGAGTGAGGCAGG + Intronic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
977113826 4:92995330-92995352 GTGGGAAGATGGAGTGAGGAGGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978780925 4:112553185-112553207 ATGGGGAAAAGCAATGGGGATGG - Intronic
979240293 4:118441701-118441723 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
979963603 4:127050806-127050828 GTAGGGGTAAGATATGAGGATGG - Intergenic
980178111 4:129371542-129371564 GTTGGGGTAAGGTATGAGGTAGG + Intergenic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981600666 4:146485047-146485069 GTGGGTAAAAGGGATGAGGTGGG - Intronic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981873624 4:149515829-149515851 TTGGGGAAAAGGTATGTGGATGG + Intergenic
982802266 4:159720010-159720032 GTGTGGCTACGGAGTGAGGATGG + Intergenic
983503136 4:168523245-168523267 GGGAGGGTAAGGAAGGAGGAAGG + Intronic
983922089 4:173357110-173357132 GTGGAGATTAGGATTGAGGAAGG + Intergenic
984753199 4:183298544-183298566 GTGAGGGAAAGGAATGGGGAAGG - Intronic
985158413 4:187017863-187017885 GTTGGGATGAGGAATTAAGAGGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
987029098 5:13959621-13959643 CTTGGGGTAAGGAATGAAGAGGG - Intergenic
987143022 5:14964642-14964664 CTGGGGATTAGGAATGGTGAAGG - Intergenic
987293622 5:16530992-16531014 GGGAGAATAAGGAAGGAGGAAGG + Intronic
988011935 5:25500047-25500069 GTGTGTATAAGGAATGAGTCTGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
989783115 5:45293934-45293956 AAGAGGATAACGAATGAGGAAGG + Intronic
990868614 5:60407015-60407037 GTAGGGATGAGGAATGAAAAAGG + Intronic
991028570 5:62058199-62058221 TTGGAGGTAAGGAATGTGGAAGG - Intergenic
991368795 5:65896524-65896546 GAGGGGATGATGAATGGGGATGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993943247 5:94087300-94087322 GGGGGGCTAAGGCAGGAGGATGG + Intronic
994167838 5:96626447-96626469 GAGGGCAGGAGGAATGAGGATGG - Intronic
994210448 5:97082642-97082664 GTGGGGATTAGGAGTCAAGAAGG - Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
994591199 5:101774877-101774899 GTCAGGTTAAGGAAAGAGGATGG - Intergenic
997702036 5:135909243-135909265 GTGGGGAGAAGGAGTGAGTCAGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997989974 5:138536523-138536545 AGGGGGAGAAGGAATTAGGAAGG - Intronic
998265875 5:140667402-140667424 GCAGAGATAAGGAATGAGGAGGG - Intronic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998511842 5:142720332-142720354 GTGGCGATAAGGCAGGAGGAAGG + Intergenic
998656830 5:144190649-144190671 GAGGGGACAAGGAAAGAGGTAGG - Intronic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
999481236 5:151950008-151950030 GTGGGGATGAGAAAGAAGGAAGG - Intergenic
1000045076 5:157515819-157515841 GTGGGGATAAAGAGTAAGGTGGG - Intronic
1001303563 5:170555299-170555321 GGGGGCAGAAGGAATGAGGTGGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002280857 5:178129448-178129470 GTGAGGGTTAGGAAGGAGGAGGG - Intergenic
1002740544 5:181432284-181432306 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
1002744517 5:181459953-181459975 GTGGGGATAGCCAATGAGCAGGG + Intergenic
1002821307 6:727468-727490 GGGGAGAGAAGGAAGGAGGAGGG - Intergenic
1004178925 6:13364630-13364652 GTGGGGATCAGGGAGGTGGAGGG - Exonic
1004321933 6:14638735-14638757 GTGGGGAGCAGAAAAGAGGAAGG - Intergenic
1005568803 6:27124596-27124618 ATGCGGACAAGGAATGTGGAGGG + Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1005891274 6:30140730-30140752 GTGGGTTGAAGGAAGGAGGAAGG + Intronic
1006079569 6:31557675-31557697 ATGGGAATAAAGAATAAGGATGG + Exonic
1006151602 6:31992955-31992977 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006157903 6:32025693-32025715 GGGAAGATAAGGAAGGAGGAAGG + Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006657547 6:35608734-35608756 GTGAGGATAGGAAATGAAGAGGG - Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1007098242 6:39227731-39227753 GCAGAAATAAGGAATGAGGATGG + Intronic
1007582970 6:42970109-42970131 GTGGGGAAAAGGAATGCAGATGG + Intronic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007789177 6:44299191-44299213 ATGGGGATCAGGAGTGTGGATGG - Intronic
1008340360 6:50356996-50357018 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1009474154 6:64067028-64067050 GTGGGGATGAAGAATGAGATTGG - Intronic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1011260389 6:85464516-85464538 GTGGGTGTCAGGAATGAGGCTGG + Intronic
1012776505 6:103500842-103500864 GTGGGGATGAGGGGAGAGGATGG - Intergenic
1012779693 6:103542021-103542043 GTTGGGGTAACGAAAGAGGATGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015801299 6:137064321-137064343 GTGGGGATAACTAAAAAGGAGGG + Intergenic
1016395164 6:143616736-143616758 ATTTGGATAAGGAATGAGGTTGG + Intronic
1016877521 6:148878780-148878802 GTGGGGATCAGGTATGAGTGTGG + Intronic
1016877525 6:148878818-148878840 GTGGGGATTATGTATGAGTATGG + Intronic
1017238231 6:152139464-152139486 GTGGGGCTGAGGCAGGAGGATGG + Intronic
1019245653 6:170707881-170707903 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
1019249427 6:170733493-170733515 GTGGGGATAGCCAATGAGCAGGG + Intergenic
1019867359 7:3724761-3724783 GAAGGAAAAAGGAATGAGGAGGG + Intronic
1020084343 7:5302614-5302636 TCGGGAAGAAGGAATGAGGAAGG + Intronic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1020842026 7:13230086-13230108 GAGGGAAAAAGGAAAGAGGAAGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022668484 7:32432736-32432758 GTGGGGGTGAGAAATGAGAATGG - Intergenic
1023478184 7:40603968-40603990 CTGGGGATAATGAAAGATGAAGG - Intronic
1023838708 7:44083131-44083153 TTGGTGTTAAGGAATGAGGAAGG - Intergenic
1023989521 7:45119768-45119790 GTAGGGATAAAGAAGGAAGACGG - Intergenic
1024242088 7:47443389-47443411 GTGGGCATAGGGGATGAGCAGGG - Intronic
1024246013 7:47471191-47471213 GTGGGGAGAAGGGGTGAGGGTGG + Intronic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1025072437 7:55912185-55912207 GTGGGGATAAAGAGTAAGAATGG + Intronic
1025620917 7:63169990-63170012 GTAGCCAAAAGGAATGAGGAGGG + Intergenic
1026008942 7:66621701-66621723 GTCAGGATAAGGAAGGAGGCTGG + Intergenic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026606909 7:71824287-71824309 GGGGGGACAATGATTGAGGAAGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026791113 7:73332548-73332570 GGGGGGATAAGGGCTGAAGAGGG + Intronic
1028490873 7:91410234-91410256 GTGGGGGTAACGATTGAGGATGG - Intergenic
1028513460 7:91650482-91650504 GTGTGGGTTAGGAATGAAGATGG - Intergenic
1028959772 7:96735602-96735624 GTGGGGAGAAGTGAAGAGGAGGG - Intergenic
1029522615 7:101073236-101073258 GGGAGGCTAAGGAAGGAGGATGG + Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029838427 7:103337507-103337529 TTAGGGATAAGAAATTAGGATGG - Intronic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1030740715 7:113106267-113106289 GTGGGGAGAAGGGATGTGGATGG - Intergenic
1031534418 7:122915876-122915898 GAGGGGAGAATGAATGAGAATGG - Intergenic
1031644372 7:124205380-124205402 ATTTGGATAAGGCATGAGGATGG + Intergenic
1031824649 7:126548165-126548187 GTGGGGTGGAGGGATGAGGAGGG + Intronic
1032147876 7:129400414-129400436 GTAGGGGTCAGGAATGGGGATGG + Intronic
1032619335 7:133511922-133511944 GTGGTGGGAAGGAATGAGAAGGG - Intronic
1032655971 7:133929840-133929862 GAAGGGATGAGGAATGAGCAGGG - Intronic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033500638 7:141945673-141945695 GTAGGGAAAATAAATGAGGAAGG - Intronic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034344903 7:150379875-150379897 GCGGGGATAAGGATTGGGGGTGG + Intronic
1034361612 7:150504443-150504465 TGTGGGATGAGGAATGAGGAAGG + Intergenic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034497611 7:151431893-151431915 GTGGTGAGAAGCAATGGGGATGG - Intronic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1034947098 7:155269348-155269370 GTGGGGTTAGAGAATGGGGAGGG + Intergenic
1035182211 7:157097656-157097678 GAGGGAATAAGAAAGGAGGAGGG + Intergenic
1035498669 8:74156-74178 GTGGGGATAGCCAATGAGCAGGG - Intronic
1035502470 8:100317-100339 GTGGGGAGAAGGGATGTGGGGGG - Intergenic
1036229389 8:6986496-6986518 GAGGGGATAAGGGATGAGGCCGG - Intergenic
1036231840 8:7005599-7005621 GAGGGGATAAGGGATGAGGCCGG - Intronic
1036233000 8:7015167-7015189 GAGGGGATAAGGGACGAGGGAGG - Intronic
1036272422 8:7319517-7319539 GTGGGGAAAAGGGATGTGGGAGG - Intergenic
1036348926 8:7990823-7990845 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1036657050 8:10683451-10683473 GAGGGGACAAGGTATGAGGATGG + Intronic
1036844187 8:12151300-12151322 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1036865561 8:12393621-12393643 GTGGGGAAAAGGGATGTGGGAGG + Intergenic
1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG + Intergenic
1037796275 8:21997843-21997865 GTGGGGGGGAGGAAGGAGGAAGG + Intronic
1037996743 8:23358077-23358099 GAGGTTATAAGGAATGAAGATGG + Intronic
1038087691 8:24218029-24218051 GTGGAGAGATGGAAGGAGGAAGG + Intergenic
1038382673 8:27111429-27111451 GTGGAGCTAAGCTATGAGGATGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1039595917 8:38789614-38789636 GTGGGGATAGGGAAGGCTGAAGG + Intronic
1039872257 8:41556452-41556474 GGGAGGATAAGGCAGGAGGATGG - Intergenic
1039976230 8:42367565-42367587 AAGGGGATATGGAATGAGAATGG - Intronic
1041814308 8:61950585-61950607 GTGGTGACAAGGCATGAGGGAGG - Intergenic
1042621759 8:70714073-70714095 GTGGGGATGAGTAAGGAGGAGGG + Intronic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043717819 8:83508143-83508165 GTGGGGATAACTAAAAAGGAGGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045581304 8:103483286-103483308 GTGGGGATGGGGAATGGGAAGGG + Intergenic
1045817749 8:106296540-106296562 GTGGTGCTAAGAAATGAGGAAGG - Intronic
1045837441 8:106538834-106538856 GTGGGGAAAAGGAAAAAGTATGG + Intronic
1046160398 8:110355584-110355606 GAAGGGGTTAGGAATGAGGATGG - Intergenic
1047092803 8:121592211-121592233 GTGGAGATAAAGAATGACAATGG + Intergenic
1047965173 8:130041164-130041186 AGGGGAAGAAGGAATGAGGAGGG - Intergenic
1048043505 8:130752498-130752520 GTGGGGACAAGGAGTCAGGGTGG + Intergenic
1048262772 8:132959654-132959676 GTGGTGATTAGGAAGGAGTATGG + Intronic
1048475643 8:134740088-134740110 GTGGGGAGATGAAATGAGAAGGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051190044 9:14501807-14501829 GGGGAGAGAAGGAAGGAGGAAGG - Intergenic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053568762 9:39281847-39281869 GTGAAGATAAGGAATGGGGAGGG - Intronic
1053834731 9:42122878-42122900 GTGAAGATAAGGAATGGGGAGGG - Intronic
1054090397 9:60840812-60840834 GTGAAGATAAGGAATGGGGAGGG - Intergenic
1054111808 9:61116369-61116391 GTGAAGATAAGGAATGGGGAGGG - Intergenic
1054128382 9:61337160-61337182 GTGAAGATAAGGAATGGGGAGGG + Intergenic
1054595808 9:67064650-67064672 GTGAAGATAAGGAATGGGGAGGG + Intergenic
1054877167 9:70109023-70109045 GACTGGATAAGGAAGGAGGATGG + Intronic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055115143 9:72597872-72597894 GTGAGGTTATGGAATGAAGATGG - Intronic
1055555582 9:77470224-77470246 GTGGGGCTAAGAAATCTGGATGG + Intronic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1056079095 9:83072242-83072264 ATGGGCAGAAGGTATGAGGATGG - Intergenic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1057492360 9:95530923-95530945 GTGGAGATAATGAATGAGAATGG + Intergenic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058766083 9:108184086-108184108 GTGGGGAAGAGTAATGAGGCCGG - Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059718681 9:116937301-116937323 GTGGTGACAGGGAATAAGGAAGG - Intronic
1059970122 9:119658635-119658657 GTATGGAGAAGGAAGGAGGATGG + Intergenic
1060024536 9:120160170-120160192 GTGGGGCAAAGTAATGAGAAAGG + Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060518823 9:124282495-124282517 GGGGGCGTAAGGGATGAGGAGGG + Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1062384204 9:136302660-136302682 GTGGGGATTAGGAGTCATGAAGG - Intronic
1062469776 9:136697167-136697189 GTTGAGATAAGGATGGAGGAAGG - Intergenic
1203605853 Un_KI270748v1:57092-57114 GTGGGGAGAAGGGATGTGGGGGG + Intergenic
1203610326 Un_KI270748v1:90432-90454 GTGGGGATAGCCAATGAGCAGGG + Intergenic
1186399332 X:9242236-9242258 GTGACTAGAAGGAATGAGGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187440050 X:19310170-19310192 GTGTGGAGAATGGATGAGGAGGG + Intergenic
1187527390 X:20066386-20066408 GTGGGAATGAGGAAGGGGGATGG + Intronic
1187531774 X:20103581-20103603 ATTAGGATCAGGAATGAGGAAGG - Intronic
1187553110 X:20325785-20325807 GAAGGGAGAAGGAGTGAGGATGG + Intergenic
1188236630 X:27739729-27739751 GTGAGGATTAGGGATGAGGATGG - Intronic
1188269421 X:28120261-28120283 GTGGGGCTAAGGAACAAGGCTGG - Intergenic
1189197654 X:39165746-39165768 GTGGGGAGGAGCAGTGAGGAGGG - Intergenic
1189914264 X:45841490-45841512 GTGGTGCTATGGGATGAGGAAGG - Intergenic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1191091389 X:56626274-56626296 GTGGGGAGAAGAAAAGAGGAGGG + Intergenic
1191133951 X:57043859-57043881 TTGGGGATGAGGTATGTGGATGG - Intergenic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1191870296 X:65739920-65739942 GTGGGGACAAGGAAAAAGGGAGG - Exonic
1192141541 X:68650697-68650719 GTGGGGCTGAGGCAGGAGGATGG + Intronic
1192191485 X:68994019-68994041 GTGAGGATGAGGGAAGAGGATGG + Intergenic
1192790543 X:74378348-74378370 GTGGGGATAATGAATGGAAAAGG - Intergenic
1194784476 X:98064817-98064839 GGTGTGATAAGGAATGAGGGTGG + Intergenic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195809702 X:108816222-108816244 TTGGGGAAAAGGTATGTGGATGG - Intergenic
1196422510 X:115537544-115537566 GTGAGGCCAAGGAAAGAGGATGG + Intergenic
1196427687 X:115588694-115588716 GTGGGGCAAAGGGATAAGGAGGG - Intronic
1196624820 X:117866360-117866382 TTGGGGATAAGGGATGATGTTGG - Intergenic
1196761744 X:119207070-119207092 ATGGGGTAAAGGAATGTGGATGG + Intergenic
1198436297 X:136620047-136620069 GTAGGGCTTAGTAATGAGGAAGG - Intergenic
1198791629 X:140353128-140353150 GTAGGGAAAAGGAAGGGGGATGG - Intergenic
1200915048 Y:8564211-8564233 GTGAGGCTAAGGATTAAGGAAGG + Intergenic
1202173820 Y:22079355-22079377 GTGGGCATAAAGAAGGAAGAAGG + Intronic
1202217540 Y:22507027-22507049 GTGGGCATAAAGAAGGAAGAAGG - Intronic
1202325645 Y:23689032-23689054 GTGGGCATAAAGAAGGAAGAAGG + Intergenic
1202545126 Y:25981022-25981044 GTGGGCATAAAGAAGGAAGAAGG - Intergenic