ID: 1052922911

View in Genome Browser
Species Human (GRCh38)
Location 9:33986903-33986925
Sequence GCACCTATTAAAGGCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052922906_1052922911 11 Left 1052922906 9:33986869-33986891 CCATTTCCAAACCTCTTGTACAT 0: 1
1: 0
2: 0
3: 26
4: 274
Right 1052922911 9:33986903-33986925 GCACCTATTAAAGGCAAAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 195
1052922908_1052922911 0 Left 1052922908 9:33986880-33986902 CCTCTTGTACATAACCTTATCAA 0: 1
1: 0
2: 1
3: 8
4: 114
Right 1052922911 9:33986903-33986925 GCACCTATTAAAGGCAAAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 195
1052922907_1052922911 5 Left 1052922907 9:33986875-33986897 CCAAACCTCTTGTACATAACCTT 0: 1
1: 0
2: 0
3: 6
4: 138
Right 1052922911 9:33986903-33986925 GCACCTATTAAAGGCAAAGAAGG 0: 1
1: 0
2: 1
3: 9
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052922911 Original CRISPR GCACCTATTAAAGGCAAAGA AGG Intronic
906188658 1:43881368-43881390 GCACATATTAGAGACACAGACGG + Intronic
908428546 1:64032811-64032833 TCAACTTTTAAAGTCAAAGATGG + Intronic
909804370 1:79856664-79856686 GCACCTAGAGAAGGCACAGAAGG - Intergenic
910409965 1:86932187-86932209 GCACGTATTAAAGACAAATTTGG + Intronic
910993502 1:93079603-93079625 GCAAGTATAAAAGGGAAAGATGG + Intronic
911562237 1:99419979-99420001 GCAGTTAAAAAAGGCAAAGAAGG + Intergenic
914248750 1:145904909-145904931 GCACTTCTTACATGCAAAGAAGG + Intronic
916605594 1:166339396-166339418 GCACCCATTGGAGGCTAAGAAGG + Intergenic
917482296 1:175422813-175422835 GCACCTATGAGAGACAAATAGGG - Intronic
917937003 1:179878130-179878152 GCTCCTCTTAATGGCACAGAGGG - Intergenic
920505192 1:206510726-206510748 GCCCCTATGCCAGGCAAAGAAGG - Intronic
923451979 1:234126579-234126601 GCACTTATGAAAGGGCAAGAGGG - Intronic
924323377 1:242871225-242871247 GCAGCTAATAAAGGCAGAGCTGG + Intergenic
1064546575 10:16456478-16456500 GCAACTATGAAAAGCAAACAAGG + Intronic
1064627028 10:17272331-17272353 GAACGTATTGAAGGCAGAGACGG - Intergenic
1066013429 10:31215116-31215138 AAACCTATAAAAGTCAAAGAAGG - Intergenic
1068129260 10:52877031-52877053 GCACCTAAGAAAGACAGAGAGGG - Intergenic
1069709578 10:70479813-70479835 GCACCTCTTAAATGCCAGGAAGG + Intronic
1069954859 10:72043722-72043744 GGGCCTATGAAAGGCAAAGGTGG + Intergenic
1070665691 10:78341921-78341943 GGACCTAAGAAAGGCAAAAAGGG - Intergenic
1071478538 10:86045238-86045260 GCAACTATTAATGGCAGAGTTGG + Intronic
1073809376 10:107135906-107135928 GAAGCTACTAAAAGCAAAGAGGG + Intronic
1074654369 10:115567299-115567321 ACACATATTAAAGGAAAAGAAGG - Intronic
1075513189 10:123088715-123088737 GCACCCATAGATGGCAAAGATGG - Intergenic
1075642206 10:124072865-124072887 GCACCCATTCAATGCAAAAAGGG + Intronic
1079814637 11:25039963-25039985 GCATGAATTAAAGTCAAAGAAGG + Intronic
1080726792 11:34906061-34906083 GCCCCTATTATATGTAAAGAAGG + Intronic
1083427366 11:62595315-62595337 GGACCTATTACAGCCAAGGAGGG - Exonic
1086866290 11:91983973-91983995 GCTCCTTTTAAAAGCAAAGTGGG - Intergenic
1088031508 11:105256898-105256920 GCACATTTTAAAGGAAAACATGG + Intergenic
1090480928 11:127067448-127067470 GTACCTATTAGTGGAAAAGATGG + Intergenic
1094194823 12:27737520-27737542 GCACCTATTAAAGAGAAAGCGGG - Exonic
1098327880 12:69321806-69321828 GCACCTCTGAATGGCAAAGCGGG - Intergenic
1100374447 12:94000576-94000598 GCACCTATTATTAGCAGAGATGG - Intergenic
1102446133 12:113004192-113004214 CCACCTCTTAAAGACAAAGGTGG + Intronic
1104250237 12:127086429-127086451 GCACATAGTAAAGACCAAGATGG + Intergenic
1106362658 13:29046746-29046768 GCATCTAACAAAGGCAAAAAGGG - Intronic
1107366491 13:39684164-39684186 GGAACTATAATAGGCAAAGAAGG + Intronic
1107656886 13:42600637-42600659 GCACCTTTGGAAGGAAAAGAGGG + Intronic
1107834428 13:44402077-44402099 GCATTTAATAAAGGCAAGGAAGG + Intergenic
1109812134 13:67526693-67526715 GCACATATTAATGCCAAACATGG - Intergenic
1110748273 13:79081452-79081474 GCAGTTAAAAAAGGCAAAGAGGG + Intergenic
1111118213 13:83809829-83809851 TCACCTATGAAAGGGATAGATGG + Intergenic
1112170740 13:96969475-96969497 GCCCCTATTACATGTAAAGAAGG + Intergenic
1113483005 13:110635328-110635350 GCACCTGTTAAAGGCCATGTAGG - Intronic
1113744511 13:112734233-112734255 GCACCAATTAAAAGCCAAGCAGG - Intronic
1117503497 14:56377265-56377287 GCACCTTTATAAGGGAAAGAAGG - Intergenic
1118671889 14:68137496-68137518 GCAACTATTAAAGATAATGATGG - Intronic
1119284654 14:73443165-73443187 GCACGTATTTAAGGTAAACAGGG - Intronic
1119902864 14:78276154-78276176 GCACCTATTCTTGTCAAAGAGGG - Intronic
1120596493 14:86445170-86445192 GCACATACTGAAGCCAAAGATGG + Intergenic
1120973426 14:90228692-90228714 TCAACTGTTAAAGGCAAAGTGGG + Intergenic
1123973845 15:25534047-25534069 GCAGGTTTTAAAGGCAAAAAAGG + Intergenic
1124796390 15:32784907-32784929 GAAGCTATTAAAAGCAAAGGAGG - Intronic
1124943360 15:34239130-34239152 GCACCTAATGGAGGCAGAGAAGG - Exonic
1125183364 15:36902835-36902857 GTACCTCTTAAAGGAAAAGCTGG + Intronic
1126939073 15:53746069-53746091 TCAGCTTTTAAAGGCAATGAAGG - Intronic
1127772061 15:62240473-62240495 GCAGCTTAGAAAGGCAAAGATGG - Intergenic
1129306167 15:74664874-74664896 GAACCTTTTAAATGGAAAGATGG - Intronic
1130566808 15:85003226-85003248 GCACCAATGACAGGGAAAGATGG - Intronic
1130660690 15:85829569-85829591 GCAACTACTAAAGGCAAAGATGG + Intergenic
1133479750 16:6158841-6158863 GCACCTATTAAAAGTGAAGTTGG + Intronic
1133792227 16:9017835-9017857 GCATCCACTAAAGGCACAGAAGG - Intergenic
1133952933 16:10412915-10412937 GCACTTAAAAAAGACAAAGAGGG - Intronic
1134200223 16:12191810-12191832 GCACCAATAAAAGGCAAGAAGGG - Intronic
1134318091 16:13138331-13138353 GCACCTATTCTAGGAAAGGAAGG - Intronic
1138142679 16:54582411-54582433 GAACTTTTTAAAGGCAAAGGTGG - Intergenic
1139922150 16:70467253-70467275 GCACCTCTAAAAGGGAAATACGG - Intronic
1141302875 16:82834394-82834416 GCATCTATTCAGGGCCAAGAAGG + Intronic
1141672475 16:85499663-85499685 GCACTTAGAAATGGCAAAGATGG + Intergenic
1142515628 17:426561-426583 GCTCTTAGGAAAGGCAAAGAGGG - Intergenic
1142542215 17:668737-668759 GCAGCTAAGAAAGGCAAAAAAGG + Intronic
1143372889 17:6451255-6451277 ACACATTGTAAAGGCAAAGAAGG + Exonic
1145876750 17:28324627-28324649 GCTCCTATAAAAGCCCAAGATGG + Intronic
1147901589 17:43789802-43789824 GGACCTAAGAAAGGGAAAGAAGG - Intergenic
1150089967 17:62314970-62314992 GGACCTATGCAAGGTAAAGAAGG + Intergenic
1150093189 17:62348674-62348696 GCAGTTAAAAAAGGCAAAGAGGG - Intergenic
1157117084 18:44871932-44871954 GCAAGTTTTAAAGGCACAGATGG + Intronic
1157160598 18:45310773-45310795 GCAGATATTAAAGCCAAAGCAGG + Intronic
1160807374 19:998365-998387 GCACCTAGAAATGGCCAAGATGG + Intronic
1165972929 19:39648514-39648536 GCTCTTATTAAAGTCAAAAAAGG + Intergenic
1166479456 19:43157711-43157733 GCACTTAAAAAAGACAAAGAGGG - Intronic
925441718 2:3893369-3893391 GCAGCTAAAAAAGACAAAGATGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928322648 2:30295718-30295740 GCATCTAACAAAGGCAAAAAGGG + Intronic
929114266 2:38431216-38431238 GCACCTACAAAATGAAAAGAGGG + Intergenic
931766076 2:65457582-65457604 GAACCTATTAAAGGTAGAGTTGG + Intergenic
931827626 2:66017972-66017994 CCACCTATTATAGGCAAACCAGG - Intergenic
935601247 2:104924115-104924137 GCACCTAAAAATGGAAAAGATGG + Intergenic
937169898 2:119855501-119855523 GCCCCTATTATATGTAAAGAAGG - Intronic
940410968 2:153362408-153362430 GCCCCTATTAAAGACACAGATGG + Intergenic
941075797 2:161005122-161005144 GTAGCTATTTGAGGCAAAGATGG - Intergenic
941289494 2:163658002-163658024 GAAACTACTAAAGGAAAAGAGGG + Intronic
944183055 2:196916845-196916867 GCTCCTACCAAAGGAAAAGAAGG - Intronic
945556020 2:211277399-211277421 ACAGATATTAAAGGCAGAGATGG - Intergenic
947965039 2:234273161-234273183 GAAACTTTTAAAGGCAAAGAGGG - Intergenic
1169566858 20:6864019-6864041 GCACATATTTAAGGCCAAGTTGG - Intergenic
1170491021 20:16875007-16875029 GCCGCTATTAAAGACAATGAGGG + Intergenic
1170623704 20:18014781-18014803 GCAGCCATTAAAGAAAAAGATGG + Intronic
1171027990 20:21649909-21649931 GCAGCTAAAAAAGACAAAGAGGG + Intergenic
1172324200 20:34021697-34021719 GCAGCTAATAAAGGCAAATCAGG - Intronic
1172931876 20:38592139-38592161 GAACCTGTGAAAGGCAAGGAAGG - Intergenic
1173209106 20:41017960-41017982 TCACCTCTTAGAGGCAAAGAGGG + Intergenic
1181766985 22:25099258-25099280 TCCCCTTTTAAAGGCAGAGAAGG + Intronic
1184003963 22:41695445-41695467 GAACATATTAGAGGCGAAGATGG + Exonic
949145840 3:699123-699145 ACAACAATTAAAGACAAAGAGGG - Intergenic
950956793 3:17062502-17062524 GCAGCTATTAAAGACAGAGGGGG - Intronic
952530799 3:34259866-34259888 TCACATGTTAAAGGCACAGATGG - Intergenic
952887273 3:38019471-38019493 CCACCAAGTAAAGGCATAGAGGG + Intronic
953945100 3:47139604-47139626 GCAATTCTTAAAGGAAAAGAGGG + Intronic
956334329 3:68146357-68146379 GCACCTCTTAAGGAGAAAGACGG - Intronic
956336081 3:68165543-68165565 GCAGATATAAAAGGCAAAGAAGG + Intronic
957754382 3:84467614-84467636 TCAACTATCAAAGGCAAAGTGGG + Intergenic
959759279 3:109940476-109940498 GCTTCTATTAAAGACAAAGTGGG - Intergenic
962147225 3:132853304-132853326 GCACATAAAAAAGACAAAGAGGG - Intergenic
964324418 3:155531268-155531290 GCAGCTATTAAAGTCCCAGATGG + Intronic
964834034 3:160917613-160917635 GCAGCTATTAAAAGCAAAAAAGG + Intronic
965154227 3:165026217-165026239 GCAGTTAAAAAAGGCAAAGATGG + Intronic
965402797 3:168233285-168233307 GAATCTAGAAAAGGCAAAGATGG + Intergenic
968125443 3:196156157-196156179 GCACTTAAAAAAGACAAAGAGGG - Intergenic
968944478 4:3656335-3656357 GCAGGTTTTAAAGGCAAAGCAGG - Intergenic
974600028 4:64066779-64066801 GAACCTATTTAAGAAAAAGAGGG + Intergenic
975068074 4:70094839-70094861 GCACCTAATTAAGGAAAATAAGG - Intergenic
976756472 4:88503697-88503719 ACACAGATTAAAGTCAAAGAAGG - Intronic
976918340 4:90406248-90406270 GCAGTTAAAAAAGGCAAAGAGGG + Intronic
977245671 4:94628301-94628323 GCATCTTTTAAAAGCAGAGATGG - Intronic
978378331 4:108098645-108098667 GCACTTATTAAAATCAGAGAAGG - Intronic
979357189 4:119718099-119718121 GCAGCTAAAAAAGACAAAGAGGG + Intergenic
980942219 4:139285447-139285469 GAAGCTAGAAAAGGCAAAGAAGG - Intronic
982051574 4:151507497-151507519 ACACATATTAAATGGAAAGAGGG - Intronic
983517919 4:168676904-168676926 GCACCTTTTAAAGTCAAGGCAGG + Intronic
984199480 4:176700008-176700030 TCAGATATTAAAGGAAAAGATGG + Intronic
986768520 5:10950056-10950078 GCACGTGTCAAAGGCCAAGATGG - Intergenic
986994191 5:13587329-13587351 GCACCCATTAAATGCAAGAAAGG + Intergenic
989096496 5:37786529-37786551 GCACCTTTTAAAGTCTAAGTAGG + Intergenic
989430363 5:41347631-41347653 GCAGCTATTAAAGGAAGACATGG + Intronic
991503362 5:67299842-67299864 ACAACCATTAAAGGCAAAGGAGG + Intergenic
992599665 5:78386209-78386231 GCACTTAAAAAAGACAAAGAGGG - Intronic
994765662 5:103913622-103913644 GAAACTATTACAGGCAATGAGGG - Intergenic
994899745 5:105756657-105756679 ACATTTATTAAAGACAAAGAAGG + Intergenic
996664050 5:126037089-126037111 CCAACTATTAAAAGCTAAGATGG - Intergenic
997000779 5:129758937-129758959 GGACCTATTAAACTCAGAGAAGG + Intronic
999599680 5:153248311-153248333 GCAGTTATAAAAGACAAAGAAGG - Intergenic
1000394849 5:160762949-160762971 ACAGCTAAAAAAGGCAAAGAGGG + Intronic
1000403787 5:160864044-160864066 GAAACTATTAAAGATAAAGAGGG + Intergenic
1000525398 5:162351641-162351663 ACACTTAAAAAAGGCAAAGAGGG - Intergenic
1004048710 6:12051505-12051527 ACACATAGTAAAGGCAAAAATGG - Intronic
1005521476 6:26604637-26604659 ACATCTTTTAAAGACAAAGATGG - Intergenic
1005601062 6:27426426-27426448 GCACCTTCTAAAGGCAGAGGAGG - Intergenic
1006101720 6:31689789-31689811 CCACCTATGACAGGCAGAGAAGG + Intronic
1008840128 6:55892981-55893003 GCAGCTAATAGAGGCAAAGGAGG - Intergenic
1011486968 6:87852844-87852866 AGACCTATTAAAGGGGAAGAAGG - Intergenic
1011535636 6:88373108-88373130 GGACTGATTACAGGCAAAGATGG - Intergenic
1015052211 6:128855046-128855068 GGACCTCTGCAAGGCAAAGAGGG + Intergenic
1015778960 6:136843756-136843778 GCAGCTATAAAAGGAATAGAAGG - Intronic
1020341287 7:7113929-7113951 GCACTTTTAAAAGGCAAAGGAGG - Intergenic
1024665413 7:51542125-51542147 GCAGTTAGAAAAGGCAAAGAGGG - Intergenic
1026227850 7:68458399-68458421 GCACCTCTCAAAGGCAAATGTGG - Intergenic
1029091833 7:98054466-98054488 GAACCTATTAAAGGTTCAGAGGG - Intergenic
1029550647 7:101235561-101235583 GCAACTATCAAAGACAGAGAAGG - Intronic
1030506018 7:110423401-110423423 ACACTTATTAAAGACAAATAAGG + Intergenic
1031440281 7:121786289-121786311 CCACCTATTAAAAGCAGATATGG - Intergenic
1032018636 7:128394655-128394677 CCACCTCTTAAGGGCAAAAACGG + Intronic
1033027027 7:137784358-137784380 GCAGCTAAAAAAGACAAAGAGGG + Intronic
1033565894 7:142577685-142577707 GAACATATTAAAGGAAAAGCAGG + Intergenic
1034392111 7:150794751-150794773 ACACCTATGAAATGAAAAGAGGG - Intronic
1037013329 8:13872398-13872420 ACACCTGTTAAAGGAAAAAAAGG + Intergenic
1039206642 8:35163001-35163023 GCAGAAATTAAAGTCAAAGAAGG - Intergenic
1040020729 8:42738476-42738498 CAAGCCATTAAAGGCAAAGAAGG - Intergenic
1041059239 8:54020472-54020494 GCACCTGTTAAAGGAAAAAGGGG + Intronic
1044614733 8:94128109-94128131 GCAAATATTAAAGGACAAGAGGG + Exonic
1045530844 8:102984014-102984036 GCATGTATTAGAAGCAAAGAGGG - Intergenic
1046075571 8:109307858-109307880 GCAGTTAAAAAAGGCAAAGAGGG + Intronic
1046196793 8:110874673-110874695 GCTCCTACTGAATGCAAAGAAGG - Intergenic
1046324629 8:112625233-112625255 GTACCTATAAAAGGTAAAGTAGG - Intronic
1046350535 8:113004548-113004570 CCACTGATTAAAGTCAAAGAAGG - Intronic
1046535852 8:115509246-115509268 GGACCTATTCCAGGCAAAGCTGG + Intronic
1046939233 8:119914883-119914905 GCAACTATTATAGTCAGAGAAGG - Intronic
1047185206 8:122626890-122626912 GCTCCTAACAAAGGCAAAGCTGG - Intergenic
1048919259 8:139213076-139213098 GCATCTATTAAAAGAACAGAAGG + Intergenic
1050500307 9:6291098-6291120 GAAACTCTTAAAGGTAAAGAAGG - Intergenic
1052222420 9:26043346-26043368 ACAGCTATTAAAAGAAAAGAAGG + Intergenic
1052305565 9:27005492-27005514 TCACTTCTTAAAGGCAAAGATGG + Intronic
1052922911 9:33986903-33986925 GCACCTATTAAAGGCAAAGAAGG + Intronic
1053345066 9:37371958-37371980 GCACCCATTAGAGGCCAGGAAGG + Intergenic
1053724922 9:40989832-40989854 TTATCTATTAAATGCAAAGAGGG - Intergenic
1054341048 9:63862169-63862191 TTATCTATTAAATGCAAAGAGGG + Intergenic
1058753986 9:108067044-108067066 GCAACTAGAAAAGGCTAAGAGGG + Intergenic
1061634501 9:131898694-131898716 GCAACTAGAAAAGGCAAGGAAGG - Intronic
1062713805 9:137992323-137992345 GCACTTAAAAAAGACAAAGAGGG + Intronic
1186441126 X:9587373-9587395 TGACCCATTAGAGGCAAAGAAGG + Intronic
1188877380 X:35446700-35446722 GCAGTTATTAAAAGCTAAGAAGG + Intergenic
1189498822 X:41534518-41534540 GCACTTATTATAGGGAAAGAGGG + Intronic
1190932560 X:54961825-54961847 GCACCTTTTACAGGCAGATATGG + Intronic
1192878335 X:75255747-75255769 GCAGTTAATAAAGACAAAGAGGG + Intergenic
1194407330 X:93513073-93513095 GCACATATTAGAGGGAAAGTGGG - Intergenic
1194669245 X:96709771-96709793 ACACCTAGAAATGGCAAAGAAGG - Intronic
1194788031 X:98110820-98110842 GCATCTATGAAAGGGAATGAGGG + Intergenic
1195076315 X:101330184-101330206 GCAACTAAAAAAGACAAAGAGGG + Intergenic
1195275151 X:103274576-103274598 TCTCCTAGGAAAGGCAAAGAAGG - Exonic
1195518998 X:105810192-105810214 ACAAAGATTAAAGGCAAAGAAGG - Intergenic
1197070085 X:122286192-122286214 GCAGATTTTAAAGGCAAAAAGGG - Intergenic
1198146449 X:133862315-133862337 GCACCTTATAAAGGTAAAGGTGG - Intronic
1198654497 X:138898901-138898923 GCCCCTATCAAAGGCTCAGAAGG + Intronic
1198733642 X:139762088-139762110 TTAGGTATTAAAGGCAAAGAAGG - Exonic
1199287801 X:146073312-146073334 GAACCTAGAAAAGGCAAGGAAGG + Intergenic