ID: 1052927868

View in Genome Browser
Species Human (GRCh38)
Location 9:34032442-34032464
Sequence GTCCCAAGGCTTCACAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052927862_1052927868 13 Left 1052927862 9:34032406-34032428 CCACCAAAGTAAGATTAACTTCC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG No data
1052927865_1052927868 -9 Left 1052927865 9:34032428-34032450 CCACTAGTTACTCTGTCCCAAGG 0: 1
1: 1
2: 5
3: 106
4: 849
Right 1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG No data
1052927863_1052927868 10 Left 1052927863 9:34032409-34032431 CCAAAGTAAGATTAACTTCCCAC 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG No data
1052927864_1052927868 -8 Left 1052927864 9:34032427-34032449 CCCACTAGTTACTCTGTCCCAAG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG No data
1052927861_1052927868 25 Left 1052927861 9:34032394-34032416 CCAGCTCTGCATCCACCAAAGTA 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052927868 Original CRISPR GTCCCAAGGCTTCACAGGAA AGG Intronic
No off target data available for this crispr